4. Which protein(s) from the list above bind(s) to regulatory switches in a sequence-specific manner? ☐ proteasomes general transcription factors lactase ☐ activators ribosomes DNA polymerase ☐ mediators RNA polymerase ☐ operons
Q: Yeast + hydrogen peroxide observation a. feels warm to the touch b. feels cold to the touch c.…
A: The question is asking about the type of reaction that occurs when yeast is mixed with hydrogen…
Q: Give 5 examples of nursing diagnoses with an elderly with lung cancer
A: The objective of the question is to identify five potential nursing diagnoses for an elderly patient…
Q: A 10 month old child whose external genitalia were ambiguous had hypertension and no dehydration. He…
A: The objective of the question is to understand the reason behind the child's hypertension and lack…
Q: https://journals.lww.com/acsm-essr/Pages/issuelist.aspx you will need to access the website and look…
A: I am also providing you a list apart from answers for the article I picked, you can refer to that,…
Q: How many siblings are in the second generation? O 10 3
A: A pedigree is a representation of the inheritance of a trait or character or disease from one…
Q: The shape of a heliodor is an X-linked trait. Male heliodors inherit two X chromosomes, while the…
A: X-linked traits are characteristics controlled by genes located on the X chromosome. In humans,…
Q: Which is NOT an example of a population bottleneck: A) The Cretaceous-Paleogene extinction event B)…
A: The objective of the question is to identify which of the given scenarios does not represent a…
Q: 2. Compare your results to those of another lab group you think this is the case? 3. Is this…
A: Answer-1:- The genotype frequencies among the parents and their kittens in the second generation can…
Q: What do cells need to take in from the bloodstream to get usable energy?
A: The question is asking about the substances that cells need to absorb from the bloodstream in order…
Q: Q1: Draw the distribution of a continuous trait like dorsal fin length with a mean fin length of…
A: Definition: Polygenic inheritance is a type of inheritance pattern where a trait is influenced by…
Q: Complex reflexes require the involvement of receptors, sensory, motor, excitatory, and inhibitory…
A: The objective of the question is to determine whether complex reflexes require the involvement of…
Q: Subject: Environmental Physiology Explain the importance of the atmosphere in the biosphere in…
A: Hi student. I hope this helps you. The atmosphere plays a crucial role in the biosphere's dynamics,…
Q: Genetics
A: DNA, or deoxyribonucleic acid, is a molecule that carries the genetic instructions for the…
Q: can i have this in more detail please
A: Tinnitus is a common auditory phenomenon characterized by the perception of sound within the absence…
Q: Briefly describe the steps in catabolism of glucose; showing the location where each step happens in…
A: Briefly describe the steps in catabolism of glucose; showing the location where each step happens in…
Q: Is the textbook, An introduction to Conservation Biology (Sher 2023), primary or secondary…
A: The objective of the question is to determine whether the textbook 'An introduction to Conservation…
Q: How much of our behavior is determined by our genes versus the environment? Provide two examples of…
A: The question is asking about the influence of genes (nature) and environment (nurture) on our…
Q: Like all viruses, HIV must utilize the host: ○ a. reverse transcriptase. ○ b. ribosomes. О с.…
A: HIV (Human Immunodeficiency Virus) is a retrovirus that targets CD4+ T cells in particular,…
Q: Which number accurately represents a chromatid? Number one or number two?
A: A chromatid is one of the two identical copies of DNA that make up a duplicated chromosome. During…
Q: If 70% of drunk drivers fail to pass a sobriety test (walking a straight line for 5 meters) in 30…
A: The objective of the question is to determine the specificity and sensitivity of a sobriety test…
Q: Considered synonymous with migration, the movement of alleles from one population to another is…
A: The question is asking for the term that describes the movement of alleles (which are different…
Q: According to the film, "Your inner reptile," which of the following did we inherit from our…
A: The film 'Your Inner Reptile' is part of the series 'Your Inner Fish' which explores the…
Q: 3. The following diagram shows some of the metabolic processes taking place in a plant cell. a)…
A: Any biological reaction that takes place in a living cell and is completely regulated by enzymes is…
Q: Asthma is a chronic disease causing bronchoconstriction. True False
A: The objective of the question is to determine whether the statement 'Asthma is a chronic disease…
Q: Explain how discrete genes can lead to continuous phenotype distributions. Your answer should…
A: Organisms are not simply classified according to one gene. Numerous characteristics, such as height,…
Q: Which is NOT true about the acrchaeopteryx fossil: A) had jaws with sharp teeth B) had three fingers…
A: The objective of the question is to identify the incorrect statement about the Archaeopteryx fossil.
Q: IV In the figure above, what is entering the cell at III? O Nat OK+ Ca² ○ Serotonin
A: The molecule entering the cell at III in the image is Ca2+ (calcium ion)Explanation:The molecule…
Q: Skin color is directly associated with other physical and behavioral traits. True or false?
A: The question is asking whether skin color, a physical trait, is directly linked to other physical…
Q: 1. Compare the calcium contents of 1/2 cup of the following foods: almond, broccoli and yogurt, 2.…
A: Nutrition is the science that defines the nutrients and other substances in food in relation to…
Q: In an immune response, what is the main function of the circulatory system? to produce…
A: The question is asking about the primary role of the circulatory system during an immune response.…
Q: Rubisco is an inefficient enzyme. Explain why you think Rubisco hasn’t evolved to become more…
A: Rubisco enzyme is the first enzyme of the light independent pathway of photosynthesis which is also…
Q: Key: with glucose without glucose
A: The image shows a bar graph with the rate of CO_2 production on the y-axis, measured in parts per…
Q: Compared to the right ventricle, the left ventricle has all the following characteristics, except…
A: The human heart consists of four chambers, two atrium and two ventricles. The blood flows into the…
Q: Q6
A: The objective of the question is to identify which of the given options is not a practice to keep…
Q: Which of the following is true about the pacemaker potential in the heart? a. Decreased K+ efflux…
A: The pacemaker potential, also known as the prepotential, is the slow, positive increase in voltage…
Q: How are amino acids grouped together? What properties do these groups have?
A: Amino acids are the building blocks of proteins, and they are classified into groups based on the…
Q: 3. In 1940 there were 12 whooping cranes in the population. In 1945, five years after hunting…
A: Question 3: To estimate the population size for whooping cranes in 1965 using the given growth rate,…
Q: Examine the chemical reaction for the hydration of the salt calcium chloride, shown below:…
A: We have given one chemical reaction that contains reactants and products. Two reactants and two…
Q: e nucleic acid polymerase with less effective transcription proof-reading and increased mutations…
A: Nucleic acid polymerases are the enzymes that help in creating polymers of nucleic acids, that is,…
Q: henotype Frequency lele Frequency enotype Frequency nvironment: Polluted Forest Moths Released G1 G₂…
A: Gene is the basic unit of heredity. A gene exists in two alternative forms called alleles. When both…
Q: Give correct typing answer with explanation
A: Decreased sensitivity to insulin signalingProlonged response to insulinReduced phosphorylation of…
Q: Which Roman deity was the wife of the first “sky-father”, and the mother of twelve Titan gods and…
A: The question is asking for the Roman deity who was the wife of the first 'sky-father' and the mother…
Q: Which diagnostic result in the patient taking furosemide requires rapid action taken by nurse Blood…
A: Furosemide is a diuretic medication commonly used to treat conditions such as hypertension and…
Q: Subject: Environmental Physiology State the percentage range of the fresh weight of plants that is…
A: The fresh weight of plants is composed of water, typically ranging from 70% to 95%. Herbaceous…
Q: Live Culture of Bacillus thuringiensis (Dipel) and B. subtilis (Kodiak) are sold as pesticides. For…
A: Answer is given below Explanation:
Q: Allowing all drunk-driving suspects (driving erratically) to complete the above sobriety test in 60…
A: The question is asking about the potential effects of extending the time allowed for a sobriety test…
Q: NATIONAL CENTER FOR CASE STUDY TEACHING IN SCIENCE Part II - Influenza in a Boarding School Note:…
A: Part II - Influenza in a Boarding SchoolQuestion 1: Adjusting Transmission Coefficient (ẞ) and…
Q: Identify the acid and conjugate base in each reaction. Calculate the pKa for each acid. List them in…
A: a. Here HC2H3O2 is acid and conjugate base is C2H3O2-Also, H2O is base and conjugate acid is H3O+…
Q: Compare the total carbohydrate (polysaccharides + fiber+ sugars) and sugar (disaccharides and…
A: 1. Each serving of 2% Lactaid milk and 2% normal milk has 13g of total carbohydrates each. The…
Q: What could the lengths of the branches on the x-axis represent? (choose all that apply, no partial…
A: The theory behind phylogenetic trees, also known as evolutionary trees, revolves around the concept…
Part 1 Bio Question 4
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- 3. A student in my lab was trying to express the cytosolic (not membrane bound) enzyme PseG and decided to express the enzyme as a Hisí fusion (PseG-His) to ease purification. In his initial experiments, he (1) expressed the protein in bacterial cells (E. coli), (2) lysed the bacteria using a gentle lysis buffer (one that would solubilize folded proteins), and (3) assessed the protein's presence in whole-cells (WC) pre-lysis, and pellet (P) versus soluble (S) cell fractions post-lysis, by SDS-PAGE analysis. In his first expression experiment, he collected the data shown in Figure 1: kD 58 46 kD MW WC PP 175 80 58 46 30 25 │I T||| || | 10- Coomassie-stained protein gel a. From these initial data, what can you conclude about the following features of PseG-His6 in E. coli? Expressed? Soluble? Folded? 10->> In a follow-up experiment, my student (1) expressed the protein in bacterial cells (E. coli), (2) lysed the bacteria using a harsh lysis buffer that included 6 M urea (a detergent), and…6. Similar to the class notes (Intro to Genetics), a segment of DNA (shown below) contains a promoter segment (the first 9 base pairs), a ribosome binding segment (the next 6 base pairs), and a segment that codes for protein synthesis which is started by the rest of the base pairs. ACTCCATTGAACCATTTCTATGATCCGCTAACG-... TGAGGTAACTTGGTAAAGATACTAGGCGATTGC-... A. When the DNA is induced to be copied to mRNA, the top strand is coding, meaning that the mRNA makes an identical copy of the lower strand (replacing T with U) The mRNA copy starts with the ribosome binding sequence. What is the sequence of the mRNA that will go to the ribosomes? B. What are the first 6 amino acids of the protein that are coded for by the mRNA? C. What would the amino acid sequence be if... i. a transition mutation occurred on the final G in the mRNA? ii. all of the G & C bases in the protein synthesis portion had transition mutations? iii. a point deletion mutation occurred in the ATA sequence (in the lower strand…6. Miraculin is a protein isolated from what is known as the "miracle berry," the fruit of a plant native to West Africa. It is described as 'miraculous' because the protein is able to alter our sense of taste. When introduced into the mouth, this protein interacts with the taste buds and makes normally sour foods taste extremely sweet-imagine biting into a lemon and tasting lemonade instead of burning acid. Researchers have created an in vitro system to test the function of this protein. Cultured cells expressing TIR2/T1R3 receptors (those that normally detect sweet taste) were tested with or without miraculin and at neutral and low pHs. Results from this experiment showing the level of sweet detection in these different treatments appear below. From these data, make conclusions about how miraculin works to affect taste. Be sure to explain your answer mechanistically. Treatment Neutral pH Low pH Sugar alone Miraculin + Sugar Miraculin alone normal detection normal detection low…
- 5. Once mTORC1 is activated, it displays protein kinase activity. It phosphorylates the hy- droxy group on serine residues on substrate proteins, many of which are involved in controlling gene expression, via the reaction: MTORC1 + ATP + substrate(Ser-OH) → MTORC1 + ADP + substrate(Ser-PO4) (a) Describe how serine is synthesized in mammalian cells including precursors, intermediates and enzymes. Where does the amino group come from? (b) Once mTORC1 has phosphorylated a serine residue on its substrate, the substrate has a phos- phoserine side chain. Is this phosphoserine side chain different than the side chain of the serine bio- synthetic intermediate 3-phosphoserine, and, if so, how? (c) When mTORC1 is inhibited by the drug rapamycin, cells perform large-scale catabolism of cyto- solic and organellar proteins by proteases in the lysosome. If a protein is phosphorylated on a serine residue and undergoes degradation in the lysosome, phosphoserine can be released back to the cy- tosol.…2. You perform a series of experiments on the synthesis of the pituitary hormone prolactin, which is a single polypeptide chain 199 amino acids long. In the first experiment, the MRNA coding for prolactin is translated in a cell-free protein synthesizing system containing ribosomes, amino acids, tRNAs, aminoacyl-TRNA synthetases, ATP, GTP, and the appropriate initiation, elongation, and termination factors. Under these conditions, a polypeptide chain 227 amino acids long is synthesized. In a second experiment, the MRNA is translated in the same cel1-free system to which you have added SRP. In this case, translation stops after a peptide about 70 amino acids long has been produced. In a third experiment, you use the same cell-free translation system to which you have added both SRP and endoplasmic reticulum vesicles, and you find that that the prolactin MRNA now produces a polypeptide that is 199 amino acids long. A) Explain these results.1. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 3’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 5’ a. What is the amino acid sequence based on this mRNA? b. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?
- 1. A DNA base sequence transcribed into messenger RNA in the following sequence: TTATCTTCGGGAGAGAAAACA. a. If you read from left to right, what amino acids are coded by this sequence? (Note: The initiation sequence is disregarded in this example.) b. If proflavine treatment caused the deletion of the first adenine nucleotide on the left, describe the changes that would occur in the first six amino acids coded by this sequence?5. A mutant strain of Salmonella bacteria carries a mutation of the rho protein t hat has full activity at 37°C but is completely inactivated when the mutant strain is grown at 40°C. (Question # 21; Chapter 8-Genetics: An Integrated Approach). Speculate about the kind of differences you would expect to see if you compared a broad spectrum of mRNAs from the mutant strain grown at 37°C and the same spectrum of mRNAs from the strain when grown at 40°C. Are all mRNAs affected by the rho protein mutation in the same way? Why or why not?6. Riboswitches are RNA sequences found in the 5' untranslated region of messenger RNA (mRNA) that control gene expression in response to small molecule binding. These regulatory elements adopt two conformations: an "on" state when a specific small molecule ligand is bound and an "off" state in the absence of ligand. When the mRNA is "off", the gene remains untranslated. The structure of a guanine-responsive riboswitch was solved in 2004 (Nature, 432, 411-415) and is shown below at low (left) and high (right) resolution with a guanine derivative bound: (see Blackboard for color image) Guanine riboswitch with a guanine derivative (red) bound; zoomed out. U22 U47 HX U51 C74 Guanine riboswitch with a guanine derivative (HX) bound; atomic detail. Note: blue = nitrogen, red = oxygen. C and U follow standard nucleotide naming conventions. a. What interactions are occurring between the riboswitch and the guanine derivative that make binding favorable? b. Of these interactions, which ones…
- 5. A peptide was cleaved into two smaller peptides with cyanogen bromide (CNBI) and into two different peptides by trypsin (Tryp). Their sequences were as follows: CNB 1: Gly-Thr-Lys-Ala-Glu CNBR 2: Ser-Met Tryp 1: Ser-Met-Gly-Thr-Lys Tryp 2: Ala-Glu What was the sequence of the original peptide?1. One type of vertebrate cell that is thought to lack integrins is the erythrocyte (red blood cell).Does this surprise you? Why or why not? 2. How are integrins able to link the cell surface with materials that make up the ECM? How do the inactive and active structures of integrins differ from one another structurally and functionally? What is the significance of the presence of an RGD motif in an integrin ligand?8. Which of the following amino acids in hemoglobin accepts proton H+ when red blood cells reach tissues? A. Histidine B. Aspartate C. Asparagine D. Glutamine E. Serine 9. Which region (A to D) of the DNA strands shown can serve as the template for transcription of the region of an mRNA that contains the initial codon for translation of a protein with 300 amino acids? B 5' AGATGCCCТАAGGTCATTGTT 3' 3' TCTACGGGATTCCAGTAACAA 5' C A. Α В. В С. С D. D E. None of the above