5. A mutant strain of Salmonella bacteria carries a mutation of the rho protein t hat has full activity at 37°C but is completely inactivated when the mutant strain is grown at 40°C. (Question # 21; Chapter 8-Genetics: An Integrated Approach). o Speculate about the kind of differences you would expect to see if you compared a broad spectrum of mRNAS from the mutant strain grown at 37°C and the same spectrum of mRNAs from the strain when grown at 40°C. Are all mRNAs affected by the rho protein mutation in the same way? Why or why not?

5. A mutant strain of Salmonella bacteria carries a mutation of the rho protein t hat has full activity at 37°C but is completely inactivated when the mutant strain is grown at 40°C. (Question # 21; Chapter 8-Genetics: An Integrated Approach). o Speculate about the kind of differences you would expect to see if you compared a broad spectrum of mRNAS from the mutant strain grown at 37°C and the same spectrum of mRNAs from the strain when grown at 40°C. Are all mRNAs affected by the rho protein mutation in the same way? Why or why not?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

Some events that take place in proteins synthesis are shown below: A. An enzyme reads the gene surface B. A transcription factor bonds to a promoter site C. An mRNA molecule is produced D. The transcript leaves the nucleus E. An MRNA polymerase attaches to the template strand Which if the following shows the correct sequence? ACEDB ЕВАCD ОВАСЕ D EACAD О САВЕD О АВСЕD В АEDC ВЕАСD EABCD
#2: Gene Translation How many ribosomes are actively synthesizing proteins at any instant in an E. coli cell growing with a doubling time of 45-minutes? Use the following assumptions in your calculations-- a. The birth size of E. coli is 1 micron in diameter and 2 microns in length. b. Water content of the cell is 80% and 50% of the dry cell mass is protein / enzymes. Also, the density of cell material is approximately 1 gram per mL. c. Rate of amino acid addition per ribosome is 20 amino acids per second, and the average molecular weight of a free amino acid is 126.
Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNA
If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
1. How would the following affect BOTH transcription and translation of a particular multi- exon gene in a eukaryotic cell (for each address both transcription and translation of a particular multi-exan gene; also treat each independently): A mutation abolishing kinase activity in TFIIH a. b. A mutation abolishing mRNA binding in the snRNP U1 С. A mutation in aminoacyl tRNA synthetase for isoleucine such that it can't bind ATP (assume there is an isoleucine in the code)
You may wish to consult the genetic code above to answer the following question. A mutation has changed a portion of a protein coding gene that encodes a messenger RNA sequence. The original messenger RNA sequence is 5'-AUGCCCAGAGCU-3' Which mutation is a frameshift mutation that changes all of the amino acids that follow the changed sequence? O 5-AUGCCCUGAGCU-3' 05-AUGCCCCAGAGCU-3" 05-AUGCCCACAGCU-3" 05 AUGCCCAGGGCC-3"
The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.
Researchers are designing and testing antisense drugs as therapies for a variety of diseases, inclusing cancer, AIDS, diabeates, and muscular dystrophy. The drugs are also being tested to fight infection by deadly viruses such as Ebola. Antisense drugs consist of short RNA strands coplementary in sequence to mRNAs that form during the progression of a disease. How do you think these drugs work?
1a.Describe the information flow in the central dogma. 1b. How does a gene specify the production of a protein? Explain in words and illustrate in a figure.
Which of the following statements are true about eukaryotic mRNA?a. The sigma factor is essential for the correct initiationof transcription.b. Processing of the nascent mRNA may begin beforeits transcription is complete.c. Processing takes place in the cytoplasm.d. Termination is accomplished by the use of a hairpinloop or the use of the rho factor.e. Many RNAs can be transcribed simultaneously fromone DNA template
What would be the direct consequence to a cell of loss-of-function of Elongation Factor-Tu (EF-Tu)? You may select multiple answers. a. tRNAs would fail to exit the E site after giving up their amino acid. b. The error rate of translation would increase. c. The ribosome would frequently fail to identify the correct start codon and initiation of translation would become less efficient. d. There would be no pause between the entry of a tRNA into the A site and peptidyl transfer.
Why might a single base-pair mutation in eukaryotic mRNA be less serious than one in prokaryotic mRNA? a. If the mutation occurs in the 5' end of the start site, it will not affect the gene product. b. If the mutation occurs in the exon, it will not affect the gene product. c. If the mutation occurs in the splice site of a transcript with alternative splicing, only one gene product may affected. O d. If the mutation occurs in the intron or not in the splice site of a transcript with alternative splicing, it will nc affect the gene product. O e. If the mutation occurs in the 3' end of the start site, it will not affect the gene product. OLIE STIC N 1A