A peptide was cleaved into two smaller peptides with cyanogen bromide (CNBr) and into two different peptides by trypsin (Tryp). Their sequences were as follows: CNB1 1: Gly-Thr-Lys-Ala-Glu CNB 2: Ser-Met Tryp 1: Ser-Met-Gly-Thr-Lys Tryp 2: Ala-Glu What was the sequence of the original peptide?
Q: Paracelsus is famous for saying that “all substances are poisons; there is none which is not a…
A: Poisons are chemicals that have the potential to kill. They are chemicals, either man-made or…
Q: The 6C14 can be substituted for 6C12 in chemical reactions in a cell because it has: (It's not…
A: Carbon is an element abbreviated as C with atomic number 6. It belongs to the 14th group in the…
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They…
A: Enzymes are biocatalysts which increase the rate of biochemical reactions. Allosteric enzymes are…
Q: Among the simplest_ , those called_, are glucose (an_) and _(a _).
A: Glucose is simple sugar which is present in body having molecular formula C6H12O6.Glucose is…
Q: Lecithins and cephalins are both
A: Lecithin are mixture of glycerophospholipids like phosphatidylcholine, phosphatidylethanolamine,…
Q: 1. What is the physiologic function of pigments in plants?
A: Pigments are compounds that absorb specific wavelengths and reflect away, the other. Plant parts are…
Q: 2) a. Give the name of the following glycoside: но. он но но b. Draw the structure of the…
A: In the question 2a, the compound has D-mannose sugar linked to a phenyl ring with O-glycosidic bond…
Q: Enumerate 10 examples of oxidation-reduction reaction that occur everyday.
A: Oxidation-Reduction reaction is also called redox reaction involves transfer of electron between two…
Q: 1.What type of bonds stabilizes the quaternary structure of proteins? * A. Peptide bond B.…
A: The structure of a protein is classified into four different levels of organizations: the primary,…
Q: Answer choices are provided below for drop-down questions. 1. The overall charge of this protein at…
A: Since you have asked multiple questions and haven't specified which has to be answered. Therefore,…
Q: His + Asp +Arg will engage this specific interaction * A. Hydrogen Bonding B. Disulfide Bonds C.…
A: Introduction: Proteins are building blocks of life and they are made up of carbon, hydrogen,…
Q: How amylase is used/its purpose and why amylase useful in the food industry
A: Amylase are the Enzymes that can digest starch into small polymers of glucose units. They can…
Q: The type of linkages found between monomer units in nucleic acids is a ether b amide c…
A: Introduction: Nucleic acids are molecules that store genetic formation for cellular growth and…
Q: Test Done and Result Carbohydrate Identity Molisch test Seliwanoff's test Benedict's test Barfoed's…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: Some of the following four amino acids : alanine, arginine, histidine, aspartic acid would provide a…
A: Introduction: Acid-base catalysis is a mechanism in which the transfer of a proton from an acid…
Q: Discuss about enzymes: function, definition, and examples.
A: At high temperatures, most of the enzymes denature and unfold similarly low temperatures…
Q: Which of the following is INCORRECTLY paired? O Isoelectric focusing : Charge O Gel filtration…
A: 1. Isoelectric focusing IEF is an electrophoretic method for separating proteins based on their…
Q: A polypeptide with a net positive charge at physiologic pH (~7.4) most likely contains amino acids…
A: The pKa values of the side chains of amino acids determine the net charge on a protein at a…
Q: Prompts Submitted Answers Eukaryotic rRNA genes are transcribed and Choose a match processed in the…
A: 1. Eukaryotic rRNA genes are transcribed and processed in the :- NUCLEOLUS.
Q: 3. Draw out the first 3 enzymatic reactions of the PPP, including listing names of S, P, coenzymes,…
A: Hi! Since you have posted multiple questions and have not mentioned which to answer, we are…
Q: What is the flow of genetic information?
A: Introduction: The first direct evidence showing that the genetic material is DNA rather than RNA or…
Q: What are the different mechanism of disease production?
A: The disease production mechanism identifies the likely source or causes of a problem/disorder, as…
Q: Ethidium Bromide is a chemical reagent that has been used to detect the presence of nucleic acids.…
A: Nucleic acids are of two types : DNA and RNA. DNA refers to Deoxyribonucleic acid. It is genetic…
Q: Dopamine, norepinephrine and epinephrine are collectively called catecholamines. Which of the…
A: Catecholamines are group of hormones made by adrenal glands and its is secreted the chromaffin cells…
Q: Why does it make sense that under conditions of low ATP levels in the cell the pyruvate carboxylase…
A: Pyruvate carboxylase (PC) is a ligase class enzyme which catalyze the irreversible carboxylation of…
Q: A HEPTAPEPTIDE that punctures the bacterial cell wall has just been recently isolated from the venom…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: ruvate through the TCA cycle. calculate the net ATPS produced from one olecule of alucose in a…
A: Oxidation of glucose molecule through a combined action of glycolysis , the TCA cycle , and…
Q: In kappa and iota carrageenans, gels are formed through double helical formation of two…
A: Carrageenans are polysaccharides comprised of repeating disaccharide units of sulfate derivatives…
Q: Explain briefly the role of the following Vitamin A in vision Vitamin C in collagen formation…
A: Vitamins are micronutrients, which are required in small amounts by the body. Vitamins are…
Q: Determine the serial dilution used from the original water sample (100 mL) with 4.8 x 105 CFU as…
A: Introduction: Dilution is the process of reducing the concentration of a solute in a solution by…
Q: What would happen to the functionality of cholic acid if the 3 hydroxy groups were removed? A)…
A: Fats are water insoluble amphipathic molecules. More than 90% of the structure of a fat is…
Q: Colchicine is used to treat gout. It alters cytoskeleton function. Why do you think it is useful for…
A: Gout is a frequent and complicated form of arthritis that can strike anyone at any time. It's…
Q: what is the importance of studying the variety, sequences, and amounts of mRNA produced in the cell?
A: The genes in DNA encode protein molecules, which serve as the cell's "workhorses," performing all of…
Q: The first loss of carbon in the metabolism of glucose takes place as CO2, in the formation of…
A: Glucose metabolism occurs in three stages. They are 1) Glycolysis 2) TCA cycle 3) Oxidative…
Q: 2 Two version of the same enzyme were isolated, a wild type and a mutant differing at a single amino…
A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation…
Q: Km value of an enzyme
A: The study of the rates of enzyme-catalyzed chemical reactions is known as enzyme kinetics. here they…
Q: Which of the following is an incorrect grouping of amino acids based on their properties of the side…
A: Introduction: Amino acid is a compound that contains an amino and a carboxyl group and a side-chain…
Q: A protein has a tertiary structure formed by interactions between the side chains of the following…
A: Two protein interacts with each other using side chain of interaction. Depending upon interacting…
Q: Given the following protein: N-MACHKGFDSTRRKYWQNKRLCVSA|IDWQSPWKNQGILV-C The overall charge of this…
A: (1)The ionizable groups in the given peptide at pH 7 are; N-terminal : it will have +1 charge…
Q: Assume the carbon atoms in a molecule of glucose are radioactive. Referencing specific compounds,…
A: Glycolysis is the first stage in the breakdown of glucose and is the metabolic process that serves…
Q: There are two types of nucleic acids-DNA and RNA, both are composed of nucleotide subunits. Complete…
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotides is…
Q: RNA processing events include A. self splicing B. methylation of 45S FRNA C. snoRNA facilitates…
A: Introduction: RNA processing involves newly transcribed RNA molecules (primary transcript)…
Q: Directionality of Polynucleotide chains originates at the ____ end, and terminates at the _____…
A:
Q: From the diagram to the right of the trp repressor in its (i) approximate binding relationship to a…
A: Given Figure shown trp repressor protein bond to DNA double strand. Protein is mainly comprised of…
Q: In polynucleotides, the phosphodiester bond is between the ______. a 3’ OH from the 3’ end,…
A:
Q: Write the structure formula, three-letter and one-letter abbreviation for each essential amino acid…
A: There are twenty naturally occurring amino acids that form proteins in biological systems.
Q: Giveee a sufficient biosynthesis for this compound starting from acetyl CoA, S-alanine, S- adenosyl…
A: Here compound 14 is synthesized from L-Phenylalanine, SAM, L-alanine, and Acetyl-CoA in multistep…
Q: 5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 9. How are Okazaki…
A: Okazaki fragments : These are pieces of DNA which are the transient components of the lagging strand…
Q: What is the general definition of an uncoupler protein? In the context of oxidative phosphorylation,…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: 1. A protein has a tertiary structure formed by interactions between the side chains of the…
A: The tertiary structure of a protein is stabilized by noncovalent interactions like hydrogen bonding,…
Step by step
Solved in 2 steps
- A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin, and the other with cyanogen bromide. Given the following sequences of the resulting fragments, deduce the sequence of the original peptide. Trypsin treatment: Asn-Thr-Trp-Met-Ile-Lys Gly-Tyr-Met-Gln-Phe Val-Leu-Gly-Met-Ser-Arg Cyanogen Bromide treatment: Gln-Phe Ile-Lys-Gly-Tyr-Met Ser-Arg-Asn-Thr-Trp-MetA sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin; the other was treated with cyanogen bromide. Given the following sequences (N- terminal to C-terminal) of the resulting fragments, deduce the sequence of the original peptide. Trypsin treatment Asn-Thr-Trp-Met-Ile-Lys Gly-Tyr-Met-Gln–Phe Val-Leu-GlyMet-Ser-Arg Cyanogen bromide treatment Gln–Phe Val-Leu-Gly-Met Ile-Lys-Gly-Tyr-Met Ser-Arg-Asn-Thr-Trp-MetA sample of a peptide of unknown sequence was treated with trypsin; another sample of the same peptide was treated with chymotrypsin. The sequences (N-terminal to C-terminal) of the smaller peptides produced by trypsin digestion were as follows: Trp-Arg-Thr-Gin Ser-Trp-Arg-His-Trp-Ala-Lys Asp-Val-Ala-Ala-Lys Asn-Ser-Asn-Val-Ile-Arg The sequences of the smaller peptides produced by chymotrypsin digestion were as follows: Arg-His-Trp Arg-Thr-Gin Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp Asp-Val-Ala-Ala-Lys-Ser-Trp The original peptide sequence was: Asp-Val-Ala-Ala-Lys-Ser-Trp-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Arg-His-Trp-Arg-Thr-Gin Asp-Val-Ala-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Arg-Thr-Gin-Ser-Trp-Arg-His-Trp-Ala-Lys Trp-Arg-Thr-Gin-Asn-Ser-Asn-Val-Ile-Arg-Ser-Trp-Arg-His-Trp-Ala-Lys-Asp-Val-Ala-Ala-Lys Arg-His-Trp-Arg-Thr-Gln-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Asp-Val-Ala-Ala-Lys-Ser-Trp Asp-Val-Ala-Ala-Lys-Ser-Trp-Arg-His-Trp-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Arg-Thr-Gin…
- You have digested a small protein with two different proteases, each protease acting on the protein in separate reactions. These are the peptide fragments generated: Trypsin: IPVK: Ile-Pro-Val-Lys ALEL: Ala-Leu-Glu-Leu HRPGDR: His-Arg-Pro-Gly-Asp-Arg FGADAEDGAMNK: Phe-Gly-Ala-Asp-Ala-Glu-Asp-Gly-Ala-Met-Asn-Lys YLEFISECIIQVLQSK: Tyr-Leu-Glu-Phe-Ile-Ser-Glu-Cys-Ile-Ile-Gln-Val-Leu-Gln-Ser-Lys Chymotrypsin: (Reaction conditions were used to maximize cutting to the C-terminal size of F, W, and Y.) LEF: Leu-Glu-Phe IPVKY: Ile-Pro-Val-Lys-Tyr GADAEDGAMNKALEL: Gly-Ala-Asp-Ala-Glu-Asp-Gly-Ala-Met-Asn-Lys-Ala-Leu-Glu-Leu ISECIIQVLQSKHRPGDRF: Ile-Ser-Glu-Cys-Ile-Ile-Gln-Val-Leu-Gln-Ser-Lys-His-Arg-Pro-Gly-Asp-Arg-Phe I am not sure what these questions are asking.A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin; the other was treated with cyanogen bromide. Given the following sequences (N-terminal to C- terminal) of the resulting fragments, deduce the sequence of the original peptide. Trypsin treatment Asn-Thr-Trp-Met-lle-Lys Gly-Tyr-Met-Gln-Phe Val-Leu-Gly-Met-Ser-Arg Cyanogen bromide treatment Gln-Phe Val-Leu-Gly-Met lle-Lys-Gly-Tyr-Met Ser-Arg-Asn-Thr-Trp-MetA sample of a peptide of unknown sequence was treated with trypsin; another sample of the same peptide was treated with chymotrypsin. The sequences (N-terminal to C-terminal) of the smaller peptides produced by trypsin digestion were as follows: Ala Ser Glu-Met-AspLys Cys-His Ile His-Arg Thr-Trp Ala Ile-Phe-Asn-Arg Trp Cys–Cys–Gln The sequences of the smaller peptides produced by chymotrypsin digestion were as follows: Glu-Met-Asp Lys-Trp Asn-ArgAla Ser Cys-His-Ile-His-Arg-Thr-Trp Ala Ile-Phe Cys-Cys-Gin The original peptide sequence was:
- 1. A certain polypeptide was treated with trypsin and yielded the following Fragments: Leu-Glu Gly-Tyr-Asn-Arg Gln-Ala-Phe-Val-Lys The same polypeptide was treated with chymotrypsin and yielded the following fragments: Gln-Ala-Phe Asn-Arg-Leu-Glu Val-Lys-Gly-Tyr What is the amino acid sequence of this polypeptide? Instructions Make use of the table below to determine the sequence of the mystery protein.4) A polypeptide is subjected to the following digestion procedures and the fragments were sequenced. What is the sequence of the original peptide? Cyanogen bromide Trypsin digestion Asp-lle-Lys-Gln-Met Lys-Phe-Ala-Met Tyr-Arg-Gly-Met Gln-Met-Lys Gly-Met-Asp-lle-Lys Phe-Ala-Met-Lys and Lys Tyr.Arg Sequence of original peptide:Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stop
- Determine the sequence of a polypeptide treated with trypsin and chimotripsine. Below are the fragments generated with each treatment. Determine the original sequence for both fragmentations (reduerde that they must be equal in the order of amino acids) Quimotripsina 1. Leu-His-Lys-Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly-Pro-Ser 1. Gln-Gln-Ala-Gln-His-Leu-Arg-Ala-Cys-Gln-Gln-Trp 2. Arg-lle-Pro-Lys-Cys-Arg-Lys-Phe Trypsin 1. Arg 2. Ala-Cys-Gln-GIn-Trp-Leu-His-Lys 3. Cys-Arg 4. Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly- Pro-Ser 5. lle-Pro-Lys 6. Light 7. Phe-Gin-Gln-Ala-Gln-His-Leu-ArgA solution of peptide of unknown sequence was divided into 2 samples. One sample was treated with trypsin and the other one with pepsin. The fragments produced are given below: TRYPSIN A. Pro-Gly-Met-Phe-Leu-Arg B. Gln-Ile-Pro-Lys C. Ala-Gly-Trp-Lys PEPSIN A. Phe-Leu-Arg-Ala-Gly В. Pro-Gly-Met С. Тrр-Lys-Gln-Пе-Pro-Lys Deduce the original polypeptide chain.Assume that the 3 polypeptide strands shown below form a parallel B-sheet. Select amino acids AA1, AA2, and AA3 so that the parallel B-sheet is amphipathic and remains stable. Glu-lle-Asn-AA1-Cys-Val Ser-AA2-GIn-Leu-Lys-Phe Lys-Met-Cys-Leu-AA3-Val O AA1 = Pro, AA2 = Leu, AA3 = lle O AA1 = Val, AA2 = Leu, AA3 = Asn O AA1 = Ala, AA2 = Gly, AA3 = Leu AA1 = Phe, AA2 = Arg, AA3 = Ala O O