АТAGGCATAGGCCCATATGGСАТAAGGCTTTАТААТАТ- GCGATAGGCGCTGGTCAG

Q: You are using a spectrophotometer to determine the concentration of DNA in a PCR product, but your…

A: The concentration of DNA and RNA should be determined by measuring the absorbance at 260 nm (A260)…

Q: If you design a set of primers for a PCR reaction, please describe the temperature that you will set…

A: PCR This is Polymerase Chain Reaction. This technique is used to amplify the specific sequences of…

Q: Which of the following pairs of sequences would be considered different alleles in DNA profiling?…

A: DNA profiling employs highly variable conserved regions known as variable number tandem repeats…

Q: Is the given statement that the first step of PCR process involves heating of DNA solution TRUE or…

A: The reaction that is used to make the duplicates of a particular DNA segment is known as polymerase…

Q: The target sequence for a PCR amplification is shown below. When the final cycle of PCR has ended,…

A: The polymerase chain reaction (PCR), often known as "molecular photocopying," is a rapid and…

Q: Suppose that you would like to amplify the DNA sequence below by a PCR reaction. Design 8 nucleotide…

A: Primer is a shory stretch of nucleotides which binds to 3' end of template DNA. It provides free OH…

Q: Based on the restriction enzyme specificities given below, what was the enzyme utilized to produce…

A: An enzyme that recognizes a specific sequence on the DNA strand and cuts the DNA into fragments is…

Q: If you wanted to prepare only one PCR reaction, how much of each reagent would you add to the PCR…

A: Standard PCR reagents include a set of appropriate primers for the desired target gene or DNA…

Q: To verify the is indeed inside your plasmid, you'd like to do a colony PCR. But you need primers for…

A: introduction you can confirm the presence of gene within the vector by two ways either by…

Q: A 3000 bp circular DNA was treated with both HindIII and EcoRI restriction enzymes. EcoRI cuts at…

A: In this question, we are given two restriction enzymes EcoRI and HindIII with their restricting…

Q: Select two primers from the list below such that your selected primers create a pair capable of…

A: Primer is a short strand of nucleotide sequence which helps in synthesis of DNA. After the…

Q: A researcher wants to cut this piece of linear DNA. 5'…

A: The restriction enzymes are the specific enzymes that act on the DNA molecule and perform its…

Q: annealing temperature

A: Answer:Annealing temperature depends the Tm of the complementary regions of your primer with the…

Q: Based on the restriction enzyme specificities given below, what was the enzyme utilized to produce…

A: The corner stone of genetic engineering or recombinant DNA technology is a special class of enzymes…

Q: be used for a restriction fragment length polymorphism (RFLP) diagnostic assay to identify…

A: Polymerase chain reaction, or  as we say PCR, is a technique used to make many copies of a specific…

Q: sequence shown below is the 5' to 3' strand of a dsDNA template. You are asked to design PCR primers…

A: The polymerase chain reaction (PCR) is a laboratory (in vitro) technique for generating large…

Q: Tell me how did you prepared the gel if the tray is 150 ml? how many milliliters of the TBE and how…

A: The answer to the first question is, 3 grams of agarose in 150 ml of TBE.   *to get the second…

Q: Construct a detail linear restriction map according to the given information in Table 1 below. Table…

A: Total size of DNA= 11 kb EcoRI has one restriction site cutting it into 2 fragments of 2kb and 9kb…

Q: R. Alu 100 100 300 F ----- 100 100 Where would you expect to see a band or bands if you used PCR to…

A: 500 bp template was prepared by using amplified PCR with forward and reverse primers of 100 bp each…

Q: What primers will be used to sequence your PCR product where are those sequences on your PCR product…

A: PCR is a technique used for amplification of DNA/gene of interest. At the end of the PCR technique…

Q: Calculate the annealing temperature (Tm in °C) for the PCR primer below. Do not include units when…

A: Answer. Polymerase chain reaction (PCR), the annealing temperature is the temperature during which…

Q: Name four reagents used during a PCR reaction

A: Polymerase chain reaction: It is an in vitro technique that results in the exponential…

Q: Template DNA: 5’ ATGACGGAATATAAGCTGGTGGTGGTGG---GGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’ 3’…

A: Template DNA: 5’ATGACGGAATATAAGCTGGTGGTGGTGGGGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’…

Q: You amplify the DNA sample shown with the indicated primers. Highlight in yellow the region that…

A:

Q: What is the sequence of the sample DNA submitted for sequencing given the gel electrophoresis…

A: Sanger sequencing method is chain terminating method.

Q: Explanation of why mutations vary in likelihood of causing disease depending on location relative to…

A: Phenylketonuria is caused due to a genetic mutation in the PAH gene( phenylalanine hydroxylase…

Q: If a uidA amplicon generateed by PCR is 200bp and the DNA fragments resulting from the restriction…

A: INTRODUCTION Polymerase Chain reaction This is the method of amplification of of nucleic acids such…

Q: The following DNA sequences were used to generate a contig from a genome sequencing project.…

A: Sequencing It is a method through which the complete genetic makeup of the organism is identified.…

Q: Another restriction enzyme is called HaellI. It cuts DNA at the following base sequence: CCGG GGCC…

A: restriction enzymes are those enzymes which helps in cutting dna at specific locations .

Q: hich of the following ARE part of a typical PCR reaction mixture?     DNA ligase     dNTPs (mix…

A: Ans-  dNTPs(mix ofdeoxynucleoside tri-phosphates )

Q: Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of…

A: The molecule, which is responsible for the genetic inheritance in most living organisms is…

Q: You have a 100 micromolar stock solution of dNTPs in the freezer and are setting up a PCR reaction…

A: PCR is the polymerase chain reaction. In this exact amount of reagents to be added in order to…

Q: What would be the final primer concentration if 0.5 μl of 10 μM primers were added to a PCR reaction…

A: In laboratory work, the volume and concentration plants an important role. Slight difference in…

Q: You are asked to design PCR primers (18 nucleotides) to amplify the coding region (without the stop…

A: If you cloned your DNA of interest between the BamHI and EcoRI sites, you could sequence using the…

Q: Which of the sequences below would serve as a PCR primer that would bind this DNA strand: 5'-…

A: PCR is polymerase chain reaction. It is a method of DNA amplification developed by Kerry Mullis.…

Q: If the Hinfl restriction enzyme recognizes G^ACTC sites, as seen in the image, belUW. GACTC How many…

A: The cloning of DNA is the mechanism by which a certain fragment of DNA is multiplied. The selected…

Q: Write down the primers spesific to Theileria annulata enolase. Calculate the Tm for each primer and…

A: Hi, Thanks For Your Question.  Answer : Because We Are Using pUC19 As A Vector, The Primers Should…

Q: CGATTGCAGGTTATAGCG. Which of the following primer pair can be used to amplify this template with…

A: Polymerase chain reaction can be used to make large quantity of DNA from a small DNA sample. In this…

Q: For the given restriction enzyme: BslI (CCNNNNN^NNGG)  i) Approximately how many fragments would…

A: Restriction endonucleases are enzymes that does cleavage of DNA at specific sites. These specific…

Q: Design PCR primers for the DNA sequence given below and explain your choice. As part of your answer,…

A: PCR It is a Polymerase Chain Reaction which is a technique through which a specific fragment of DNA…

Q: The sequence below shows 140bp of a double-stranded DNA sequence coding for histone H2A. What two…

A: PCR or polymerase chain reaction is a rapid and versatile in vitro technique for amplification of…

Q: ook at each PCR component listed below.  For each one, determine which steps(s) of the PCR reaction…

A: PCR is the polymerase chain reaction in which a particular sequence is amplified. PCR requires many…

Q: Entire sequence below needs to be amplified by PCR and subcloned into a plasmid vector. Which of the…

A: PCR, or the polymerase chain reaction, is a technique used by molecular biologists to amplify…

Q: For the following short sequence of double stranded DNA and the given primers, there will be one…

A: Polymerase chain reaction (PCR) is generally used to produce millions or even billions of copies in…

Q: . Draw the melting curve for primer annealing, labeling the axes. Label the position of the…

A:

Q: Suppose that you want to sequence the following DNA fragment: 5′–TCCCGGGAAA-primer site–3′ You first…

A: The sequencing involves replicating the desired sequence to be sequenced in the presence of the…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.