Answered: Explain the process of replication of…

Science

Biology

Explain the process of replication of DNA and why you come up with that DNA strand in the previous question. *

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter21: Dna, Genes, And Biotechnology

Section: Chapter Questions

Problem 1RQ: Why is DNA replication called semiconservative?

See similar textbooks

Related questions

Q: Name all the enzymes involved in DNA replication along with their respective function

A: DNA replication is the biological process that results in the production of two identical copies of…

Q: Match the following descriptions with the enzymes involved in DNA replication. 1. Adds an RNA primer…

A: Replication is the synthesis of new DNA molecules from the parental DNA.

Q: Explain what semiconservative means with respect to DNA replication.

A: The replication of DNA is semiconservative in nature as every new strand of DNA double helix is…

Q: List the steps involved in the replication of DNA.

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…

Q: Explain how the double helical structure of the DNA suggests a mechanism for DNA replication

A: DNA or deoxyribonucleic acid is the genetic material that is responsible for carrying the genetic…

Q: Explain in details the conservative replication of DNA and the dispersive replication of DNA

A: DNA replication is a process that takes place in every biological cell. It involves coping and…

Q: the semi-conservative DNA replication

A: DNA replication is a process that involves the formation of identical copies of DNA from the…

Q: During DNA replication, why doesn’t DNA polymerase move away from the replication fork on both…

A: When the replication of the DNA takes place, an enzyme called helicase begins to unwind the double…

Q: Explain why DNA replication is called semiconservative.

A: Genetic material present in nucleus of a cell i.e., DNA contains the instructions for protein…

Q: Explain why the replication of DNA is semiconservative.

A: In the process of DNA replication, the complete DNA of the cell is replicated or copied. Each strand…

Q: What is the name of the locations that DNA replication begins along the DNA molecule?

A: DNA replication is the natural cycle of creating two indistinguishable replicas of DNA from one…

Q: Explain the concept of DNA replication ?

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: Describe the roles of helicase and topoisomerase in DNA replication

A: DNA replication is the process of copying the single DNA strand into two identical copies. It…

Q: Discontinuous replication is a result of which property of DNA? a. Complementary bases b. Charged…

A: The synthesis of a new strand of a replicating DNA molecule as a series of short fragments that are…

Q: DNA replication is said to be semiconservative because a. one of the new molecules conserves both of…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Explain how the lagging dna strand is copied during dna replication? What are the enzymes involved?

A: The nascent deoxyribonucleic acid (DNA) consists of one leading strand and one lagging strand.

Q: Explain the three major steps in DNA replication.

A: Answer: Introduction: The semi-conservative replication means in which two copies of original DNA…

Q: Explain the synthesis of the leading and lagging strands during DNA replication and identify the…

A: The enzyme DNA polymerase with an RNA primer can synthesize new strands in the 5' to 3' direction.…

Q: Describe the semi-conservative nature of DNA replication.

A: DNA (deoxyribonucleic acid) is the hereditary unit of an organism. DNA is formed of nucleotides…

Q: Determine the complementary strand of DNA that forms on this template DNA fragment during…

A: The complementary strand of the DNA fragment during the replication : 3' CCAAAGAAGTTCTCT 5'

Q: Explain the process of DNA replication.

A: The deoxyribonucleic acid (DNA) is the double-stranded molecule that is the genetic material in most…

Q: Analyze the experiment of Meselson and Stahl and explain how the results were consistent with the…

Q: Describe how the synthesis of new DNA strands begins at anorigin of replication.

A: Replication is the process of formation of copy of DNA strand.

Q: Describe the process of DNA replication of the leading strand?

A: DNA replication It is the process by which DNA make exact copy of itself. The replication of DNA is…

Q: What is needed for DNA replication to take place? Explain using a figure which illustrates there…

A: DNA replication is a process of producing two identical DNA replica similar to the parent DNA.

Q: The enzyme required to open up the double stranded DNA during replication and form the replication…

A: Replication Replication is a process by which the DNA synthesised exact copies of itself. This is…

Q: Explain the term origin of replication.

A: Deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains that coil around…

Q: What enzyme initiates DNA replication? a. ligase b. helicase O c. primase d. gyrase

A: Which enzymes initiates the DNA replication? DNA replication is bidirectional and originates at a…

Q: Explain the steps in DNA replication.

A: DNA replication takes place in 3 steps.

Q: A mutation results in the presence of multiple DNA fragments on the newly synthesized DNA strand…

A: DNA is a double helical structure made of two complimentary strands. The two strands in a double…

Q: Explain the definition of DNA replication and list general steps of Replication

A: DNA replication means when a double-stranded DNA molecule is copied to produce two identical DNA…

Q: Compare DNA replication on the leading and lagging strands, includingboth similarities and…

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: explain the feature of DNA replication and how this replication is considered accurate

A: DNA replication is the interaction by which a double stranded DNA molecule is duplicated to create…

Q: describe the function of Helicase, and DNA Polymerase in the DNA replication process.

A: DNA helicases are fundamental during DNA replication since they separate double stranded DNA into…

Q: Single-stranded regions of DNA are attacked by nucleasesin the cell, yet portions of DNA are in a…

A: DNA replication is the process of synthesizing new strands of DNA from the original double-helical…

Q: During DNA replication, the two new daughter DNA strands have to be made at the same time in the…

Q: Using the illustration of DNA replication given below label the following:

A: DNA is the hereditary material. At the point when the cell separates, the girl cells get an…

Q: Describe all steps of DNA replication.

A: DNA replication is the process by which new DNA is synthesized from the old DNA. In prokaryotic…

Q: Explain what will happen to the products of replication if DNA polymerase I is absent.

A: DNA polymerase 1 provides three distinct catalytic activities: 3′ to 5′ exonuclease, 5′ to 3′…

Q: List the steps of DNA replication.

A: Formation of new DNA from pre existing one is known as DNA REPLICATION The basic steps are:-…

Q: Describe which are Three possible models of DNA replication?

A: DNA is composed of two chains that are twisted around one another to form a double helix.…

Q: Draw a diagram of DNA replication that has the double-stranded DNA with the replication bubble, has…

Q: During DNA replication, the proteins that ensure denatured templates are not re- natured are called…

A: DNA replication is a process that is involved in the production of the two identical copies of the…

Q: What would happen to the replication process if the growing DNA chain did not have a free 3' end?

A: DNA replication is the process by which a double stranded DNA molecule is copied to produce two…

Q: List the differences and similarities in the way the twodaughter strands of DNA are synthesized at a…

A: DNA (deoxyribonucleic acid) is the genetic material of almost all living organisms. It is a double…

Q: Determine whether the following statement regarding eukaryotic DNA replication is true or false: DNA…

A: Introduction Chromosomes are structures found within the nucleus of various cells. DNA, which…

Q: Describe what are the enzymes and proteins involved in DNA replication?

A: Describe what are the enzymes and proteins involved in DNA replication?

Q: Describe the purpose of DNA replication.

A: DNA is made up of two stands that are twisted around each other in a double helix form. DNA copies…

Concept explainers

Fungal Infections

Fungal infection can be defined as an infectious disease caused by fungi. A fungal infection is also referred to as mycosis. Fungal infections are contagious, spreading from person to person. Mycosis can be contracted even from an infected animal or contaminated soil. The most common symptom is skin rashes and vaginal discharge in females.

Question

TACCCCGAGTCCCTGGCGTTAAAACAGTGCCGAATC

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Below is a diagram of DNA replication as currently believed to occur in E. coli. Arrows start from numbers and end at specific points. Answer the questions relating to the locations specified by the numbers (1) Which end (5' or 3') of the molecule is here? (2) Which enzyme is probably functioning here to deal with supercoils in the DNA? (3) Which enzyme is probably functioning here to unwind the DNA?
Briefly discuss the pros and cons of having a nucleoid (as bacteria do) versus a double nuclear membrane surrounding the DNA (as in eukaryotes). List and explain three reasons why DNA replication is very accurate.
Below is a diagram of DNA replication as currently believed to occur in E. coli. From specific points, arrows are provided that lead to numbers. Answer the questions below relating to the locations specified by the numbers. (02) What end (5’ or 3’) of the molecule is here? (State which) What enzyme is probably functioning here to deal with supercoils in the DNA? What enzyme is probably functioning here to unwind the DNA? What nucleic acid is probably depicted here? What are these short DNA fragments usually called? What enzyme probably functions here to couple these two newly synthesized fragments of DNA? Is this strand the leading or lagging strand? What end (5’ or 3’) of the molecule is here? (State which)
Name and describe the first four events (and associated enzymes) that happen during DNA replication at the DNA double helix (in correct sequence)
Why is DNA replication is considered a semi-discontinuous process? Explain in detail.
If DNA is replicating in a cell, how does it do this? Describe the mechanism of replication.
Explain why DNA replication is called semiconservative.
(a) Eukaryotic DNA replication is more complex than prokaryotic replication. Give one reason why this should be so. (b) Why might eukaryotic cells need more kinds of DNA polymerases than bacteria?
in DNA replication, if the template strand is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the newly synthesized DNA strand? Write the sequence from 5’ to 3’.
With illustrative diagrams, explain the three theories of DNA replication..
Match the DNA replication model with its description and image.
Explain why DNA replication proceeds only in the 5′ to 3′direction.