sequence shown below is the 5' to 3' strand of a dsDNA template. You are asked to design PCR primers to amplify the sequence that is in bold and our chosen primers within the underlined region rather than in the flanking sequence.) CAGTTAACTGGTТАТАAGAAACCTсстТCAAGAGAGсТТАААGTTACATIшссстеAстTAААТGGTG TGTGGTGGCTATTGATTATAAACACTACACACCCTCTTI TAAGAAAGGAGCTAAATTGTTACATAAACC-3 Nhat is the 5' to 3' sequence of the reverse primer? O 5-TTC GTC CAA AGA ATA TTC-3

Q: If you design a set of primers for a PCR reaction, please describe the temperature that you will set…

A: PCR This is Polymerase Chain Reaction. This technique is used to amplify the specific sequences of…

Q: How can DNA microarrays be used to determine which genes of a bacterial pathogen are expressed both…

A: DNA microarray or biochip is a technique wherein different DNA molecules are first attached to a…

Q: For this activity you will draw out the first steps of the PCR reaction, using the following as a…

A: Introduction  PCR is the revolutionized technique invented by Karry Mullis in 1983, for which he got…

Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…

A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…

Q: a PCR-based crime scene investigation, similar to the one presented in the lab module with Brother Y…

A: DNA sample taken from a crime scene is compared with a DNA sample from a suspect. If the two DNA…

Q: The target sequence for a PCR amplification is shown below. When the final cycle of PCR has ended,…

A: The polymerase chain reaction (PCR), often known as "molecular photocopying," is a rapid and…

Q: You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its…

A: As organisms evolve, their DNA and protein sequences change. According to the molecular clock…

Q: You design primers that will amplify a 400 bp fragment of the CAT gene and perform PCR. The 400 bp…

A: PCR is a technique that helps in the amplification of a target gene or a specific region of DNA. The…

Q: Suppose that you would like to amplify the DNA sequence below by a PCR reaction. Design 8 nucleotide…

A: Primer is a shory stretch of nucleotides which binds to 3' end of template DNA. It provides free OH…

Q: With regards to this sequence below please answer this quistions 1) What is the format of the…

A: answer given below

Q: You are interested in amplifying the putative gene encoding the 480-bp protein TMR (Total Memory…

A: We are given with the gene that is needed to be amplified by PCR. The image shows a region of DNA…

Q: A linear piece of DNA was broken into random, overlapping fragments and each was sequenced. The…

A: Introduction DNA is an organic chemical that contains genetic information as well as instructions…

Q: You would like to amplify the gene shown here using PCR.  Assume the primer to the 5' end of the…

A: PCR stands for Polymerase Chain Reaction. This is used to amplify the gene of interest.

Q: Which forward are reverse primers will amplify the following sequence by PCR?…

A: As given in the question, forward and reverse primer sequences are to be identified to amplify the…

Q: There are four possible observations that suggest an error occurred in a PCR reaction: a) Sequence…

A: PCR reaction is a method used to amplify a small sample into millions of small ones which help the…

Q: You want to perform PCR on the CDNA of the spike gene from a SARS CoV-2 sample so that you can…

A: PCR stands for polymerase chain reaction. It is used to amplify the gene of internet because forward…

Q: Select two primers from the list below such that your selected primers create a pair capable of…

A: Primer is a short strand of nucleotide sequence which helps in synthesis of DNA. After the…

Q: The figure below depicts the start of the CDNA sequence of the gene AGAMOUS from the model plant…

A: Central dogma was proposed by Francis Crick. The RNA is formed from DNA with the help of enzyme RNA…

Q: be used for a restriction fragment length polymorphism (RFLP) diagnostic assay to identify…

A: Polymerase chain reaction, or  as we say PCR, is a technique used to make many copies of a specific…

Q: Why might a PCR reaction not work for a 3500bp region you want to amplify when the reaction worked…

A: In molecular biology, the polymerase chain reaction is a method that is employed to amplify a target…

Q: Examine the sequence for the DNA fragment below. Your job is to design primers for PCR that would be…

A: A primer may be a brief single-stranded nucleic acid utilized by all living living beings within the…

Q: Draw a diagram of what occurs in PCR during the annealing step of the FIRST cycle. b. Draw a diagram…

A: The PCR or polymerase chain reaction is a routinely used technique in molecular biology. It is used…

Q: Imagine that you correctly prepare your PCR reaction mixture, but there is something wrong with the…

A: The polymerase chain reaction is the PCR in which the genes are amplified i.e make millions to…

Q: Examine the DNA sequence shown below. You have been tasked with designing Primers for PCR…

A: Polymerase chain reaction (PCR) is a method widely used to make many copies of a specific DNA…

Q: A linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced.…

A: An overlapping gene fragment is a gene whose nucleotide sequence partially overlaps with that of…

Q: Here you see the gel electrophoresis of PCR reactions of the pMCT118 VNTR locus of 4 individuals…

A: Answer pMCT118 VNTR  locus has multiple repeats that can be analyzed by Polymerase chain reaction…

Q: You wish to amplify gene Y alone from the double-stranded DNA shown in the figure below. Identify…

A: Primer binding sites for the amplification of gene "Y" only.

Q: Suppose you have to design two PCR primers, 16 bases in length, to amplify the whole of the 100 bp…

A: Primers are short nucleic acid molecule, that are single stranded in nature and area prerequisite…

Q: You amplify the DNA sample shown with the indicated primers. Highlight in yellow the region that…

A:

Q: In your PCR reaction, you were able to use the same primer set, even though you were likely…

A: PCR is a molecular biology tool that is useful in a variety of ways. It is used in forensic…

Q: The typical cycle of a PCR reaction includes a period of time at 95 degrees, 55 degrees, and 72…

A: PCR which is also called as Polymerase Chain Reaction is a method used in DNA amplification of…

Q: Suppose that you would like to amplify the DNA sequence below by a PCR reaction. Design 8 nucleotide…

A: A primer is defined as the short single-stranded DNA sequence, required in the polymerase chain…

Q: The sequence 5' GCCTAATGCGTTCATAATGGCGTTTGCCACGGACGTAAAGTCGT 3' represents 50% of a PCR product…

A: Agarose gel electrophoresis used to separate DNA according to its molecular weight. On agarose gel,…

Q: The following DNA sequences were used to generate a contig from a genome sequencing project.…

A: Sequencing It is a method through which the complete genetic makeup of the organism is identified.…

Q: Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of…

A: The molecule, which is responsible for the genetic inheritance in most living organisms is…

Q: The following bacterial DNA genome is composed of three sequences: TGGCGGT / ACGTTAC / GGATAGG Using…

A: Clustered regularly interspaced short palindromic repeats or CRISPR is a family of nucleotide…

Q: You are asked to design PCR primers (18 nucleotides) to amplify the coding region (without the stop…

A: If you cloned your DNA of interest between the BamHI and EcoRI sites, you could sequence using the…

Q: CGATTGCAGGTTATAGCG. Which of the following primer pair can be used to amplify this template with…

A: Polymerase chain reaction can be used to make large quantity of DNA from a small DNA sample. In this…

Q: How many molecules (target sequence copies) will be produced by 30 PCR cycles? Assume you start with…

A: The Polymerase Chain Reaction(PCR) was invented by Kary B. Mullis in the year 1985 to amplify scare…

Q: Design PCR primers for the DNA sequence given below and explain your choice. As part of your answer,…

A: PCR It is a Polymerase Chain Reaction which is a technique through which a specific fragment of DNA…

Q: The exponential nature of PCR allows spectacular increases in the abundanceof a DNA sequence being…

A: Polymerase chain reaction, or PCR, is a technique to make many copies of a specific DNA region in…

Q: The sequence below shows 140bp of a double-stranded DNA sequence coding for histone H2A. What two…

A: PCR or polymerase chain reaction is a rapid and versatile in vitro technique for amplification of…

Q: ook at each PCR component listed below.  For each one, determine which steps(s) of the PCR reaction…

A: PCR is the polymerase chain reaction in which a particular sequence is amplified. PCR requires many…

Q: We usually think of enzymes as being most active at around 37°C, yet in PCR the DNA polymerase is…

A: PCR, like DNA replication in an organism, necessitates the use of a DNA polymerase enzyme to create…

Q: The following DNA fragment shows where a number of restriction endonucleases cut sites occur within…

A:

Q: Image 1. Which 2 primers from the choices provided would work to amplify the DNA sequence given…

A: DNA strand for deoxyribose nucleic acid. It is the genetic material present in the cell.

Q: Suppose you were interested in generating a PCR amplicon including the bracketed sequence below.…

A: PCR or Polymerase Chain Reaction is a specialized type of method which is used to obtain copies of…

Q: Suppose that you are given a short fragment of DNA to sequence. You amplify the fragment with PCR…

A: DNA sequencing is a method to determine the sequence of the DNA molecule. Electrophoresis enables…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.