Evolution
Evolution
4th Edition
ISBN: 9781605356051
Author: Douglas Futuyma, Mark Kirkpatrick
Publisher: SINAUER
bartleby

Videos

Question
Book Icon
Chapter 4, Problem 1PDT

a.

Summary Introduction

To determine: The primary eight amino acids for each of the given DNA sequences, which are given as follows:

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

a.

Expert Solution
Check Mark

Explanation of Solution

The given DNA sequences are as follows:

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

The amino acids from the above DNA sequences using the codon table are given below:

MetSerLeuThrAsnLysAsnVal MetAlaLeuThrAsnLysAsnVal MetSerLeuThrAsnLysAsnValMetSerLeuThrAsnLysAsnValMetSerLeuThrAsnLysAsnVal

b.

Summary Introduction

To determine: The five polymorphic sites and signify whether the site is represented by synonymous or non-synonymous polymorphisms in the given DNA sequences.

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

b.

Expert Solution
Check Mark

Explanation of Solution

The process of polymorphism results in the modification of the nucleotide. The “synonymous polymorphism” is defined as the production of the same type of amino acid after the modification in the nucleotide.

The synonymous or non-synonymous polymorphisms in sequences are as follows:

MetSerLeuThrAsnLysAsnVal  - SynonymousMetAlaLeuThrAsnLysAsnVal - Non-synonymous MetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - Synonymous

The production of “alanine” in the second sequence fulfills the criteria of polymorphism.

c.

Summary Introduction

To determine: The one-difference intermediate in the production of TTG from CTC.

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

c.

Expert Solution
Check Mark

Explanation of Solution

According to the provided information, the CTC sequence is responsible for the production of TTG sequence. Both the codons code for “Leu.” However, the codon that could be the intermediate of the process could be the same as “leu.” TTC codes for the “Phe” when activated; hence, it cannot be the intermediate in the reaction. Hence, the one-difference intermediate must be CTG, which also codes for the “Leu” that forms the bridge in the production of TTG from the CTC codon.

d.

Summary Introduction

To determine: The reason that synonymous polymorphisms are likely to be more frequent than non-synonymous polymorphisms.

ATGTCTCTCACCAACAAGAACGTCATGgCTCTCACCAACAAGAACGTCATGTCgCTCACCAACAAGAACGTCATGTCTtTgACCAACAAGAACGTCATGTCTCTCACCAACAAGAACGTg

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

d.

Expert Solution
Check Mark

Explanation of Solution

There is a repetition of “3-letter codes” along the codon for the coding of specific amino acid. The production of new amino acid takes place when there is a change in the second element, resulting in non-synonymous polymorphism. However, changes in the third element of the codon give the similar amino acid. Thus, synonymous polymorphisms are likely to be more frequent than non-synonymous polymorphisms.

MetSerLeuThrAsnLysAsnVal  - SynonymousMetAlaLeuThrAsnLysAsnVal - Non-synonymous MetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - SynonymousMetSerLeuThrAsnLysAsnVal - Synonymous

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!
Students have asked these similar questions
Below are the DNA sequences that encode the first eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that differ from the first sequence are shown by a lowercase letter. ATGTCTCTCACCAACAAGAACGTC ATGgCTCTCACCAACAAGAACGTC ATGTCgCTCACCAACAAGAACGTC ATGTCTtTgACCAACAAGAACGTC ATGTCTCTCACCAACAAGAACGTg a. What are the first eight amino acids for each of these five DNA sequences? b. For each of the five polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism. c.The fourth sequence shown above has two mutational differences from the first sequence. Specifically, the third codon is TTG versus CTC in the first sequence. These two codons are two mutational steps away from each other. Supposing that the CTC sequence gave rise to the TTG sequence, do you think it is more likely that the one-difference intermediate was TTC or CTG? d. In general, synonymous polymorphisms tend to be more common than nonsynonymous…
You have the following sequence reads from a genomic clone of the Drosophila melanogaster genome:Read 1: TGGCCGTGATGGGCAGTTCCGGTGRead 2: TTCCGGTGCCGGAAAGARead 3: CTATCCGGGCGAACTTTTGGCCGRead 4: CGTGATGGGCAGTTCCGGTGRead 5: TTGGCCGTGATGGGCAGTTRead 6: CGAACTTTTGGCCGTGATGGGCAGTTCCUse these six sequence reads to create a sequence contig of this part of the D. melanogaster genome.
A portion of the sequence from the DNA coding strand of the chick ovalbumin gene is shown. Determine the partial amino acid sequence of the encoded protein. CTCAGAGTTCACCATGGGCTCCATCGGTGCAGCAAGCATGGAA-(1104 bp)-TTCTTTGGCAGATGTGTTTCCCCTTAAAAAGAA Enter the 3-letter abbreviation for each amino acid in sequence, separated with dashes, and no spaces (example: xxx-xxx-XXX-XXX...) The amino acid sequence is .1104bp..…........
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Embryology | Fertilization, Cleavage, Blastulation; Author: Ninja Nerd;https://www.youtube.com/watch?v=8-KF0rnhKTU;License: Standard YouTube License, CC-BY