Life: The Science of Biology
11th Edition
ISBN: 9781319010164
Author: David E. Sadava, David M. Hillis, H. Craig Heller, Sally D. Hacker
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 19.4, Problem 1R
Summary Introduction
To review:
The authenticity of the conserved nature of the developmental genes from the story of the eye-determining genes, Pax6 and eyeless.
Introduction:
Development is the process, by which a simple zygote undergoes a series of changes so as to develop into a much more complex organism. The genes that control the developmental process are much of a concern for biologist as it allows them to study and also decipher the developmental pattern of other organisms as well. These genes can remain conserved within distinctly related species or can encounter changes with the course of evolution.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
You isolate a glp-1 mutation of C. elegans and discover that the DNA region encoding the spatial control region (SCR) has been deleted. What will the GLP-1 protein expression pattern be in a four-cell embryo in mutant heterozygotes? In mutant homozygotes?
Dominguez et al. (2004) suggest that by studying genes that determine growth and tissue specification in the eye of Drosophila, much can be learned about human eye development. (a) What evidence suggests that genetic eye determinants in Drosophila are also found in humans? Include a discussion of orthologous genes in your answer. (b) What evidence indicates that the eyeless gene is part of a developmental network?
Dominguez et al. (2004) suggest that by studying genes that determine growth and tissue specification in the eye of Drosophila, much can be learned about human eye development. (a) What evidence suggests that genetic eye determinants in Drosophila are also found in humans? Include a discussion of orthologous genes in your answer. (b) What evidence indicates that the eyeless gene is part of a developmental network? (c) Are genetic networks likely to specify developmental processes in general? Explain fully and provide an example.
Chapter 19 Solutions
Life: The Science of Biology
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Explain the Retrotransposons—the Copia –White-Apricot System in Drosophila ?arrow_forwardWhat would be the most likely result of injecting bicoid mRNA into the posterior end of a Drosophila embryo and inhibiting the translation of nanos mRNA?arrow_forwardEarly development depends on the temporal and spatial interplay between maternally supplied material and mRNA and the onset of zygotic gene expression. Maternally encoded mRNAs must be produced, positioned, and degraded [Surdej and Jacobs-Lorena (1998). Mol. Cell Biol. 18:2892–2900]. For example, transcription of the bicoid gene that determines anterior– posterior polarity in Drosophila is maternal. The mRNA is synthesized in the ovary by nurse cells and then transported to the oocyte, where it localizes to the anterior ends of oocytes. After egg deposition, bicoid mRNA is translated and unstable bicoid protein forms a decreasing concentration gradient from the anterior end of the embryo. At the start of gastrulation, bicoid mRNA has been degraded. Consider two models to explain the degradation of bicoid mRNA: (1) degradation may result from signals within the mRNA (intrinsic model), or (2) degradation may result from the mRNA’s position within the egg (extrinsic model).…arrow_forward
- Locate a gene expression data set on Gene Expression Omnibus using "expression by hybridization" involving Rabies virus or related virus Use GEO2R to perform pairwise group analysis Explore and identify the most regulated genes: gene/protein functions of Rabies virusand Define the significance of these genes/proteins in the disease process.arrow_forwardAbsence of bicoid mRNA from a Drosophila egg leads to theabsence of anterior larval body parts and mirror-imageduplication of posterior parts. This is evidence that the productof the bicoid gene(A) normally leads to formation of head structures.(B) normally leads to formation of tail structures.(C) is transcribed in the early embryo.(D) is a protein present in all head structures.arrow_forwardHow does the chromosomal genetic system in animals permit both precise control of gene content and expression in cells and an opportunity for enormous amounts of genetic variation?arrow_forward
- As we have learned in this chapter, the Nanos protein inhibits the translation of hunchback mRNA, lowering the concentration of Hunchback protein at the posterior end of a fruit-fly embryo and stimulating the differentiation of posterior characteristics. The results of experiments have demonstrated that the action of Nanos on hunchback mRNA depends on the presence of an 11-base sequence that is located in the 3′ untranslated region (3′ UTR) of hunchback mRNA. This sequence has been termed the Nanos response element (NRE). There are two copies of NRE in the 3′ UTR of hunchback mRNA. If a copy of NRE is added to the 3′ UTR of another mRNA produced by a different gene, that mRNA is repressed by Nanos. The repression is greater if several NREs are added. On the basis of these observations, propose a mechanism for how Nanos inhibits Hunchback translation.arrow_forwardWhat are paralogous and orthologous genes? What are some of the explanations for the finding that humans are a much more complex organism than the roundworm C. elegans, yet have only about 5 percent more protein- coding genes (21,000 versus 20,000)?arrow_forwardWhat kind of response is seen via temperature stress in Drosophila? Are these kinds of elements conserved in all organisms? What is the role of the final protein element translated?arrow_forward
- . Let’s say that you have incredible skill and can isolate the white and red patches of tissue from the Drosophila eyes shown in Figure 12-24 in order to isolate mRNA from each tissue preparation. Using your knowledge of DNA techniques from Chapter 10, design an experiment that would allow you to determine whether RNA is transcribed from the white gene in the red tissue or the whitetissue or both. If you need it, you have access to radioactive white-gene DNAarrow_forwardBy whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model. You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos? You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA? 5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’ After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…arrow_forwardIt seems that developmental genetics boils down to a complex network of gene regulation. Try to draw a structure of this network for Drosophila. How many genes do you think are necessary to complete the developmental network for the fruit fly? How many genes do you think are needed for a network to specify one segment? Do you think it is more difficult to identify genes that are involved in the beginning, middle, or end of this network? Suppose you were trying to identify all of the genes needed for development in a chicken. Knowing what you know about Drosophila development, would you first try to identify genes necessary for early development, or would you begin by identifying genes involved in cell differentiation?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY