Concept explainers
Videos
Eukaryotic mRNA:
usessnRNPs to cut out introns and seal together translatableexons.
uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice.
has a guanine cap on its 39 end and a poly(A) tail on its 59 end.
is composed of adenine, thymine, guanine, and cytosine.
codes the guanine cap and poly(A) tail from the DNAtemplate.
Introduction:
The messenger ribonucleic acid (mRNA) is that type of RNA that transcripts the DNA (deoxyribonucleic acid). RNA polymerase synthesizes a precursor of mRNA (pre-mRNA) in eukaryotes, which is then processed to form mRNA that is in a translatable form. The mRNA attaches to the ribosome where the amino acids bind to form polypeptide chains.
Answer to Problem 1TYK
Correct answer:
The eukaryotic mRNA uses snRNPs to cut out introns and seal together the translatable exons.
Explanation of Solution
Justification for the correct answer:
Option (a) states that the eukaryotic mRNA uses snRNPs to cut out introns and seal together translatable exons. The snRNPs (small nuclear ribonucleoprotein particles) bind to the pre-mRNA to form a complex spliceosome. The spliceosome breaks the pre-mRNA to remove nonprotein coding RNA sequences called introns and joins the coding RNA sequences named exons that can be translated. Hence, option (a) is correct.
Justification for the incorrect answers:
Option (b) states that eukaryotic mRNA uses a spliceosome mechanism made up of the DNA to recognize the consensus sequences to cut and splice. The spliceosome is a complex sequence formed by pre-mRNA and small nuclear ribonucleoprotein particles (snRNPs). The spliceosome breaks the pre-mRNA to remove the nonprotein coding sequences called introns. So, it is an incorrect option.
Option (c) states that the eukaryotic mRNA has a guanine cap on its 3′-end and the poly (A) tail on its 5′-end. The pre-mRNA process includes a capping enzyme that adds a cap at the 5′-end and at the 3′-end. The enzyme poly (A) polymerase adds a chain of adenine nucleotides at the 3′-end and 7-methylguanosine cap is added to the 5′-end of pre-mRNA. Thus, it is an incorrect option.
Option (d) states that the eukaryotic mRNA is composed of adenine, thymine, guanine, and cytosine. In the mRNA, there is uracil in the place of thymine. Both of these are pyrimidines that attach to adenine. So, it is an incorrect option.
Option (e) states that the eukaryotic mRNA codes the guanine cap and the poly (A) tail from the DNA template. This is incorrect because the guanine cap and the poly (A) tail in mRNA is not coded from the DNA template. A capping enzyme adds a cap at the 5′-end and at the 3′-end. The enzyme poly (A) polymerase adds a chain of adenine nucleotides, which makes the poly (A) tail of mRNA. So, it is an incorrect option.
Hence, options, (b), (c), (d), and (e) are incorrect.
Thus, it can be concluded that in the eukaryotes, small nuclear ribonucleoprotein particles (snRNPs) bind to the pre-mRNA to form a complex spliceosome. The spliceosome breaks the pre-mRNA to remove the nonprotein coding sequences called introns and joins the coding RNA sequences called exons, which can be translated.
Want to see more full solutions like this?
Chapter 15 Solutions
Biology: The Dynamic Science (MindTap Course List)
- Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.arrow_forwardAssume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into mRNA, and then translate it into the polypeptide. Give the polypeptide sequence in the following form: Met-Thr-Trp-Tyr-Val etc. 3' TCACAATACAAAGGTGTACTGATCTCATCTCCATAA 5'arrow_forwardA mRNA sequence is shown below. Note that the coding strand of DNA has the same sequence as the mRNA, except that there are U’s in the mRNA where there are T’s in the DNA. The first triplet of nucleotides AAU (underlined) is in frame for coding, and encodes Asparagine. 45 50 55 60 65 5’—A A C G A A U C G U C G C C A A C U A A G A G –-3’ Which of the following DNA mutations is almost certain to result in a shorter than normal protein? at position 56 a change from G to C an insertion of a G after the G at position 56 inversion of region 56-59 (G C C A) an delete the C at position 52 None of the above.arrow_forward
- Several different nucleic acids are involved in the process of getting a protein produced from a gene. DNA contains the "genetic code" for the protein. DNA is double-stranded, but only one strand is transcribed into MRNA. The MRNA then goes into the cytoplasm where it is translated into protein with the help of TRNA. At each stage of the process, there is base complementarity (A pairs with T/U and C pairs with G) between the nucleic acids involved to ensure the integrity of the DNA blueprint for the protein being produced. Therefore, some of the four strands of nucleic acids involved will match (except U replaces T in RNA) and some will have base complementarity. Indicate whether there is matching (1) or base complementarity (2) between the following nucleic acids. DNA sense strand and MRNA DNA sense strand and tRNA DNA antisense strand and MRNA MRNA and TRNAarrow_forwardIndicate which of the following items are associated with transcription or translation. This could be in prokaryotes or eukaryotes, or both. Group of answer choices: Translation OR Transcription Sigma binds to the promoter mRNA binds to the small ribosomal subunit Spliceosomes remove introns and splice together exons Nucleotides are added from the 5' to 3' end tRNA anticodon binds to the corresponding mRNA codon STOP codon results in terminationarrow_forwardAssume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into mRNA and then translate it into the polypeptide. Give the polypeptide sequence in the following form: Met-Thr-Trp-Tyr-Val etc. 5' ACCGAAGGACTTATGGAGCGCTCATGATTTGCT 3'arrow_forward
- For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acidarrow_forwardAt least three types of RNA are required for protein synthesis. Compare and contrast mRNA, FRNA, and tRNA by moving the descriptions of their structure and function to the appropriate categories. Some phrases may describe all three types of RNA. MRNA FRNA tRNA MRNA, FRNA, and tRNA Answer Bank contains nucleotide triplets that code for specific amino acids acts as an enzyme for peptide synthesis has a convoluted structure with a three-base sequence called an anticodon moves amino acids to the site of protein synthesis in eukaryotes, can exist outside the nucleus moves genetic information out of the nucleus and into the cytoplasm composed of ribonucleic acidarrow_forwardThe coding DNA strand of a gene has the following DNA sequence: 5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’ 1) Find the sequence of the mRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the T is substituted with A (count from 5’ end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!arrow_forward
- Hydrogen bonds are important in DNA replication and transcription. They are relatively weak chemical bonds. Why is this a desirable feature for DNA? Describe the effect (s) of changing (mutating) the promoter on the transcription of the DNA strand/gene the promoter controls. What happens to protein synthesis if a nonsense codon is inserted into the gene? Explain why a point mutation does not necessarily change the original amino acid sequence. (Explain silent mutations) Choose any pentapeptide composed of five different amino acids. List the amino acids. Present one messenger RNA codon for each amino acids and the sequence of nucleotides on the DNA that originally coded for your pentapeptide.arrow_forwardLike mRNA, tRNA has a ribose sugar, U instead of T, and is single stranded. Unlike mRNA, which remains a long single strand of nucleotides, tRNA folds so that some areas pair up. The resulting structure has an anticodon on one end and a site for an amino acid to attach on the other end. There is base complementarity (A pairs with U and G pairs with C) between an mRNA codon and tRNA anticodon.If the amino acid lysine attaches to a tRNA, which of the following anticodons could be at the opposite end of the tRNA molecule? a. UUU and UUC b. AAA and AAG c. AGA and AGU d. UCU and UCAarrow_forwardLike mRNA, tRNA has a ribose sugar, U instead of T, and is single stranded. Unlike mRNA, which remains a long single strand of nucleotides, tRNA folds so that some areas pair up.The resulting structure has an anticodon on one end and a site for an amino acid to attach on the other end. There is base complementarity (A pairs with U and G pairs with C) between an mRNA codon and tRNA anticodon.If the amino acid serine attaches to a tRNA, which of the following anticodons could be at the opposite end of the tRNA molecule? Select one: a. UCU and UCA b. AGA and AGU c. AGA and AGT d. UCA and ACGarrow_forward
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning