Concept explainers
In a mixed heteropolymer experiment using polynucleotide phosphorylase, 3/4G : 1/4C was used to form the synthetic message. The amino acid composition of the resulting protein was determined to be:
From this information,
- (a) Indicate the percentage (or fraction) of the time each possible codon will occur in the message.
- (b) Determine one consistent codon base composition assignment for the amino acids present.
(a)
To determine: The fraction of the time each possible codon will occur in the message formed in the given experiment.
Introduction: The heteropolymer is made up of two different monomers. The mixture of heteropolymers is used for the process of copolymerization. The amino acids are incorporated in a cell-free protein-synthesizing system in a test-tube. The process begins with a cell-lysate containing all the necessary factors for translation. This method was developed to follow the progress of translation for decoding the genetic code by radioactive labeling of one or more amino acids.
Explanation of Solution
In the given experiment, the amino acids are built from a polynucleotide sequence using only G’s and C’s. The proportion of G is ¾, and C is 1/4. The percentage that each codon will appear depends on its nucleotide proportion.
The fraction for each codon that can occur in the synthetic message is represented as follows:
Thus, the fractions for the possible codons GGG, GGC, GCG, CGG, CCG, CGC, GCC, CCC are 27/64, 9/64, 9/64, 9/64, 3/64, 3/64, 3/64, and 1/64, respectively.
(b)
To determine: One consistent codon base composition assignment for the amino acids present.
Introduction: Codon is a sequence of three nucleotides that corresponds with a specific amino acid or termination signal during translation. DNA and RNA are written in a language of four nucleotides, while the protein language includes 20 amino acids.
Explanation of Solution
In this problem, we are assuming that the genetic code is not known to us. All the given amino acids except the proline are decoded by more than one codon.
Thus, the proline (CCG) is one consistent codon base composition assignment for the amino acids present.
Want to see more full solutions like this?
Chapter 13 Solutions
Concepts of Genetics (12th Edition)
- Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?arrow_forwardBased on the N-terminal amino acid sequence, what is the approximate half-life of the protein after methionine is cleaved off?arrow_forwardKnowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human - globin gene (shown in the figure below (Links to an external site.)) into bacterial cells, hoping the cells will express it and synthesize functional - globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does -globin made by a eukaryotic cell. Explain why and give thoughts as to how to overcome this.arrow_forward
- The E. coli genome contains approximately 4639 kb. (a) How many copies of the 6-bp recognition sequence for the trp repressor would be expected to occur in the E. coli chromosome? (b) Explain why it is advantageous for the trp repressor to be a dimer that recognizes two adjacent 6-bp sequences.arrow_forwardAssume that the translational error frequency, d, is 1 * 10–4. (a) Calculate the probability of making a perfect protein of 100 residues. (b) Repeat for a 1000-residue protein.arrow_forwardThe genetic code was solved partly by the use of in vitro systems to translate synthetic RNAs into peptides. In these systems, ribosomes, amino acids, and buffers that support translation are added and there is no control of where translation begins. AAA = Lys; AUA = Ile; AAU = Asn; UAA = stop. What peptides would NOT be produced in an in vitro system if the following oligonucleotide were added: AAAAAAAAAUAAAAAAAA Select one: a) Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys b) Lys-Lys-Ile-Lys-Lys c) Lys-Lys-Asn-Lys-Lysarrow_forward
- Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human β-globin gene (Shown in Figure 17.11) into bacterial cells, hoping the cells will express it and synthesize functional β-globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does β-globin made by a eukaryotic cell. Explain why.arrow_forwardWhen the amino acid sequences of insulin isolated from different organisms were determined, differences were noted. For example, alanine was substituted for threonine, serine for glycine, and valine for isoleucine at corresponding positions in the protein. List the single-base changes that could occur in codons of the genetic code to produce these amino acid changes.arrow_forwarda) b) Shown below is a DNA sequence that encodes for a section of a protein. Please write the amino acid sequence using the three letter codes for this section. 5' ATG ACT CTC TCC TGG GGC ATC CGA TAA 3' What would the second codon be changed to if it was both a silent mutation and a transition mutation? Please write an anticodon in 5' to 3' direction that would recognize both the original second codon and the mutated second codon.arrow_forward
- Shown here is a theoretical viral mRNA sequence 5′-AUGCAUACCUAUGAGACCCUUGGA-3′ (a) Assuming that it could arise from overlapping genes, how many different polypeptide sequences can be produced? Using the chart in Figure 12–7, what are the sequences? (b) A base-substitution mutation that altered the sequence in part (a) eliminated the synthesis of all but one polypeptide. The altered sequence is shown below. Use Figure 12–7 to determine why it was altered. 5′-AUGCAUACCUAUGUGACCCUUGGA-3′arrow_forwardIf the code were a sextuplet (containing of six nucleotides), would the reading frame be restored by the addition or deletion of three, six, or nine nucleotides? Would the reading frame be restored by the addition or deletion of three, six, or nine nucleotides?arrow_forwardThe genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution mutations (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons.(a) How many total mutations are possible?(b) How many of these mutations are “silent,” in the sense that the mutantcodon is changed to another Arg codon?(c) How many of these mutations are conservative, in the sense that an Argcodon is changed to a functionally similar Lys codon?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education