Q: Compare andcontrastmajor approaches inenvironmental ethics
A: Environmental ethics is a branch which deals with the studies of conceptual foundations of environme...
Q: The study by Wakefield et al. that purported to show a link between autism and the MMR vaccine was p...
A: Answer- (d) All of the above
Q: Using penci, you will draw a representation of DNA replication along the leading and lagging strands...
A: Replication is the process by which DNA duplicate and make its own copies, replication of DNA is a l...
Q: How can people effectively manage stress when diagnosed with cardiovascular conditions?
A: When people diagnosed cardiovascular conditions than how can manage stress
Q: Offer evidence in support of the hypothesis that meiosis evolvedfrom mutations in the process of mit...
A: The process that helps in the development of daughter cell from parent cell can be termed as cell di...
Q: How is the shape of the bacteria related to it's function?
A: Coccus (spherical), bacillus (rod-shaped), and spiral (twisted) are the three basic bacterial shapes...
Q: Based on the figures given, 1. What range of time and temperature combinations poses the highest ri...
A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for...
Q: Write a conclusion explaining the relationship between time and temperature
A: *The higher the temperature, more easily bacteria will grow to a certain point. *Very high and low...
Q: 4. Explain the roles of each of the S main components of the electron transport chain. What are thei...
A: Because they include a pair of electrons with a high transfer potential, NADH and FADH2 produced dur...
Q: 3. Describe the effect of malaria on the frequency of the Hbs allele in areas where is common in are...
A: Sickel cell anemia is a genetic disease in which the RBCs present in the blood changes its shape fro...
Q: Answer and explain comprehensively. 3. If humans evolved from apes, then why are there still apes?
A: Apes meaning and explanation For much of history, people have used the terms "monkey" and "ape" inte...
Q: 1. What are the main elements of the lac operon and their functions?
A: NOTE- Since you have posted multiple questions So we will be solving the first question for you. As ...
Q: 2. Distinguish among inducible, repressible, and constitutive gene operons.
A: An operon is a functional unit of genomic DNA that comprises a collection of genes that are all regu...
Q: Cytoplasm of a plant cell divides by the process of_____ . a. telekinesis c. fission b. nuclear divi...
A: Introduction Cytoplasm is a viscous liquid that fills each cell and is surrounded by the cell membra...
Q: Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA. TACCATGAGAATTGTGGTCAC...
A: Convertion of TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAA to mRNA is done and results ar...
Q: doing jumping jack. Trace the blood circulation
A: Jumping jacks are a full-body exercise that we can do anywhere, with no equipment, and target ma...
Q: two different
A: A test that checks for bacteria at the site of a suspected infection such as the throat, lungs, geni...
Q: Explain how human population, affluence, and technology affect the environment
A: Over-exploitation of natural resources, deforestation, pollution (soil, air, and water), habitat los...
Q: What is microbial community?
A: Answer :- Microbial community group are gatherings of microorganisms that share a typical living spa...
Q: A “calico” cat (left) is mainly white with patches of black and orange fur. a. Almost all calico cat...
A: Introduction: Chromosomes are the condensed form of chromatin present in the nucleus of the cells. T...
Q: 1. Describe what malaria is and where it is prevalent in what areas of the globe and in what habitat...
A: Often diseases are caused by various pathogenic microbes that are found in unhealthy and unhygienic ...
Q: Remember that although there are many interesting ideas about genetic engineering of plants and anim...
A: Transgenic bacteria are bacteria whose genome contains genes from other organisms that have been del...
Q: Explain the arm abduction and adduction at the shoulder joint together with the respective muscles i...
A: Movements in general at synovial joints are divided into four main categories i.e Gliding movement, ...
Q: Huntington disease is a neurodegenerative disease that appears in affected people late in life. It i...
A: An individual who carries a mutation for a dominant allele disorder usually is tend to be affected, ...
Q: An unknown microbe is found to be able to photosynthesize, but is also able to fix pyruvate for carb...
A: An autotroph is an organism that can produce its own food using light, water, CO2 and other chemical...
Q: Which of the following characteristics are present in Vertebrates? Choose all that apply. O triplobl...
A: 1) Triploblastic : Triploblastic animals are those in which the the blastoderm layer divides in thre...
Q: what is ASTO or ASO test? discuss the principle it's important
A: ASTO/ ASO test is Anti- streptolysin O test. Antistreptolysin O is an antibody produced in human bo...
Q: The ADP/ATP carrier, which exchanges cytoplasmic ADP and mitochondrial ATP, can also function as a p...
A: Answer :: a) Proton pumping rate, electron transport rate, rate of oxygen uptake : remains the same ...
Q: Identify
A: The organism which causes the above shown infection is Candida albicans.
Q: Proteins can be separated into 9 general classifications based on the role they play in a cell. List...
A: Proteins can be classified into following types:- Fibrous Proteins Globular Proteins Derived Protei...
Q: One of the autosomal loci controlling eye color in fruit flies has two alleles: one for brown eyes a...
A: The fruit fly's color of the eye is further controlled by the autosomal locus. The given fly compris...
Q: A bacterial cell undergoes a change and the two Trp codons of the tryptophan leader sequence are con...
A: Tryptophan operon is an example of repressible operon which remain transcriptionally active and beco...
Q: Do you think the scar would look better (i.e. the wound heal "better") if friend #2 underwent hyperb...
A: This is because the scars of Tb never heals, it cannot be reversed under any circumstances, even whe...
Q: Explain the four classification schemes of streptococci species
A: streptococci are gram positive bacteria, having spherical or oval coccus aligned in a chain form. Th...
Q: Q2 The Hardy-Weinberg equilibrium remains valid in presence of geographic isolation. (True or false)
A: Hardy Weinberg equilibrium is used to describe population genetics.
Q: Answer and explain comprehensively. 3. If humans evolved from apes, then why are there still apes?
A: INTRODUCTION Evolution is a main thing happened by a natural process that mainly occur...
Q: There are base pairing rules for writing complimentary DNA strands for a given strand. A pairs with ...
A: According to Bartleby guidelines, we are supposed to answer first three subparts in case of multiple...
Q: Control over eukaryotic gene expression drives______ . a. transcription factors c. embryonic develop...
A: In eukaryotes, gene expression is influenced by a wide range of mechanisms such as loss of genes, am...
Q: Differentiate sterilization from disinfection.
A: Methods to remove unwanted microbes from the surfaces, clothes, and bodies are important. Disinfecti...
Q: life history patterns and how different
A: Life history-A history of the changes through which an organism passes in its development from the p...
Q: compare these two techniques. Compare a nucleosome protection assay and a northern blotting is a tex...
A: Introduction: The nucleosome is the fundamental subunit of chromatin. Each of the tiny beads are cal...
Q: 1. What is the significance of the formation of the blastocoel and blastoderm during blastulation? 2...
A: Blastulation It refers to the production of blastula during the early stages of animal embryonic dev...
Q: Describe Mendel’s principles of segregation and independent assortment.
A: Mendel studied seven characters of the pea plant, Pisum sativum. Based on his findings he proposed p...
Q: 1.) Propose the biosynthesis of 5-methylorsellinic acid: CH; НО CH3 `CO,H OH
A: 5- methylorsellinic acid is a dihydroxybenzoic acid. That is O-orsellinic acid in which the hydrogen...
Q: The role of creatine phosphate in muscle cells is to: provide energy for muscles during extended phy...
A: Creatine phosphate serves as an “energy buffer” in muscle it is a high-energy, phosphorylated, nitro...
Q: 9. Two nutrient solutions are maintained at the same pH. Actively respiring mitochondria are isolate...
A: The cellular respiration is responsible for the breakdown of glucose and production of energy in the...
Q: The Calvin cycle reactions that fix CO2 do not function in the dark. What are the likely reasons for...
A: The carbon cycle can be described as the series of reactions associated with fixing carbon dioxide (...
Q: What is thermal death time? What are the factors that may influence the efficiency of chemical growt...
A: Answer 1 :- Thermal death time is the way lengthy it takes to kill a particular bacterium at a parti...
Q: Which of the following includes all of the others?a. homeotic genes c. SRY geneb. master regulators ...
A: Homeotic gene involves a group of those genes that control the pattern of anatomic developments in e...
Q: Does the mechanism of recombination of unlinked genes require crossing-over? Explain your answer.
A: No, the mechanism of recombination of unlinked genes does not require crossing-over.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- 7. Explain how the problem of antibiotic resistance presents an example of evolution. 8. Explain how natural selection could have produced the modern long-necked giraffe from short-necked ancestors.1. There are two main groups of bats: Smaller “microbats” navigate by using sonar, and larger “megabats” rely on vision. Mammalogists once thought that both kinds of bats evolve from insectivorous mammals. But similarities between the visual systems of megabats and primates have led some researchers to think that megabats may have evolved from primates, perhaps lemurs. What results would support the hypothesis that the two groups of bats have a common origin? Separate origins?19. Humans no longer use their tailbones, but the human tailbone structurally resembles the tails of other mammals. This is an illustration of A. homologous structures. B. analogous structures. C. missing links. D. vestigial structures.
- 2. Birds have evolved over the last 60-70 MY. To learn about their relatedness, we can use DNA sequences. Because DNA evolves at a relatively steady rate, gene sequences in two different organisms will accumulate sequence changes and become more different with time. The longer ago their common ancestor was, the more different their sequences will be. However, some genes are under more selection and so evolve slowly. Other genes are under less selection and so evolve quite quickly. Assuming that sites change linearly with time, we can calculate how many sites differ when comparing genes between different species. For simplicity we'll assume we are comparing 1000bp of sequence for each of these genes. Species compared Canary and olive finch Canary and house finch Canary and zebra finch Canary and robin Canary and chicken a. Why do the three genes differ in the number of variable sites between different species? Canary Olive finch House finch Zebra finch robin chicken Canary # of sites…7. Identify 3 species that would likely have homologous structures (structures that are constructed similarly but might have a different function such as the bones in the wings of a bat, or the bones in the fin of a whale). Explain why they are likely to have these structures?1. Determine if the following are: HOMOLOGOUS, ANALOGOUS, VESTIGIAL structures ________1a. Human appendix and coccyx are nearly non-functional. ________1b. Bird and bat wings have the same function but are not constructed in the same way. ________1c. The upper forelimbs of humans and bats have similar skeletal structure, yet very different in appearance and function.
- 1. Process of adaptation is one of the keys toward survival of species. Which of the following is NOT an example of adaptation? A. Dying out of dinosaurs during cretaceous period. B. Certain group of birds eating different kinds of food. C. The finches of Galapagos with different beaks. D. A child learning to walk on his own. 2. Why do organisms with close biochemical similarities show stronger evolutionary relationships? A. They have varied and different ancestry B. They have similar patterns during early stages of development C. They have common ancestor and have the same kind of proteins D. They possess same vestigial structure that made their evolutionary relationship closer. 3. Where do most fossils be found? A. Sedimentary rocks C. Lava flow B. Granite rocks D. Black soil 4. What is the best statement to supports the idea that extinction is necessary? A. To give way for organisms to develop B. To let other organisms evolve and progress…1. List 3 to 5 kinds of animals that belong to the same group that may differ in appearance. 2. Are they alike in structure? Explain. 3. Are they alike in functions? 4. Can they breed or mate with one another only? 5. Do they have common ancestry? 6. Define species based on the question given.3. Linear evolution suggests that there is a ladder, or step- progression, to evolution over time -- one species building and transitioning into another species. A bushy interpretation of evolution suggests multiple overlapping species of hominins, with some species short-lived, and others existing for a long period of time. What type of evolutionary model does A. sediba support? Explain your answer.
- 2. Jeąn-Baptiste Lamarck's explanation for the evolution of long-necked giraffes from shorter- neckêd okapi-like ancestors on a savanna would include all of the following features except: A. over time, inheritance of acquired characteristics in okapis would lead to savanna giraffes B. once an okapi had acquired a longer neck, it could pass on this new trait to its offspring C. okapis in a savanna habitat found it advantageous to stretch their necks for treetop leaves D. each individual okapi could increase its neck-length by deliberate, consistent exercise E. only those okapis with favorable traits (long necks) could be ancestral to savanna giraffes5. Analogy and homology are important concepts used in comparing species. Which of the following pairs of structures are analogous and which are homologous? a. The dorsal fins of a porpoise and a salmon b. The jointed leg of a ladybird beetle and a robin c. A siamang ape’s tail and a human coccyx d. The bright red bracts of a poinsettia and the green leaves of a rose e. The bright red bracts of a poinsettia and the red petals of a rose9. TRUE OR FALSE: Evidence of small-scale evolutionary changes is directly observed in an organism with short life cycles.