7. Explain how the problem of antibiotic resistance presents an example of evolution. 8. Explain how natural selection could have produced the modern long-necked giraffe from short-necked ancestors.
Q: You isolate bacteria from several different pools at the recreation center. Curious about which…
A: BLAST are the tools that are used to identify the differences and similarities between the protein…
Q: What things actually make water become contaminated?
A: Water plays critical role in the biological processes of living organisms. Water is a key component…
Q: d) RNA Seq is used to determine off-target effects of Cas9 cleavage. Why is this an appropriate tool…
A: The ground-breaking gene-editing tool CRISPR-Cas9 has quickly established itself as an essential…
Q: Which of the following are potential uses for iPS Cells? O Development of patient specific therapies…
A: Pluripotent cells are a type of stem cell that have the ability to differentiate into any of the…
Q: Question 6. What color of E. coli colonies do you expect to have after plating transformed cells of…
A: Transformation is a process by which foreign DNA is introduced into a cell, resulting in a change in…
Q: Why is the application of ice a useful therapy for inflammation?
A: Inflammation is defined as the immunological response of the body tissue against the pathogens or…
Q: A molecular researcher, Dr. Sidra Alkatini, is investigating the manifestation of a disorder in some…
A: A codon is a sequence of three nucleotides (a triplet) that encodes a specific amino acid or signals…
Q: The electrochemical gradient across membranes is important in determining movement across membranes…
A: The electrical potential difference arises due to the separation of charges across the membrane,…
Q: Please complete the following question fully. Question 7 This question is in regards to one of the…
A: To orient two carboxylic groups (COOH) so that the methylene portions that would normally form…
Q: 5. Drawing upon the results of this exercise, why is Pseudomonas aeruginosa of such concern in burn…
A: Pseudomonas aeruginosa is a common bacterium that poses a significant threat to certain vulnerable…
Q: Which is the correct answer. I don't see it in your response.
A: The propagation of nerve impulses from one neuron to the next neuron occur at the synapse. The axon…
Q: A child with cystic fibrosis can be born to two parents who do not have the disease, but who both…
A: The genetic disorder Cystic Fibrosis (CF) affects the respiratory, digestive, and reproductive…
Q: How does the circulatory system transport oxygen and nutrients to the body's tissues?
A: Digesting the food in the alimentary canal and absorbing oxygen from external environment by…
Q: Which of the following traits has the greatest narrow-sense heritability? Circle the letter in the…
A: The proportion of the total phenotypic variation in a particular trait that is due to additive…
Q: PLEASE ANSWER THE QUESTION AND EXPLAIN SUCCINTLY IN 2 SENTENCES Assuming that the A2 allele is…
A: The A2 allele being recessive and producing a deleterious trait in the A2A2 genotype raises…
Q: For Meal Worm give the reader background on the relevant science like the species, life cycle,…
A: We will study how they grow, where they like to live, and how their body works. We will also look at…
Q: Gq (subunit of g-protein): a) inhibits adenylyl cyclase b) activates adenylyl cyclase c) causes the…
A: Cell signaling, also known as cell communication or signal transduction is the process by which…
Q: 7. A botanist wanted to see if a new strain of corn could germinate in soil that was too salty for…
A: Salinity is an important environmental factor that can restrict plant growth and lower crop yields.…
Q: 2. Imagine you are a farmer researching the impact of GMFs. What is one advantage and one…
A: GMO stands for genetically modified organism. It refers to an organism whose genetic material has…
Q: One ml of a sample was added to 99 ml of buffer. 100 µ of this was plated in nutrient agar. After…
A: A colony-forming bacterium is a microorganism that is capable of growing and dividing on a solid…
Q: Influenza virus is an RNA virus with a segmented genome whereas SARS-Cov-2, the cause of COVID19…
A: The influenza virus and SARS-CoV-2, the causative agent of COVID-19, are both RNA viruses, but they…
Q: Discussion of a minimum of five aesthetic value that you derive from biodiversity.
A: Biodiversity refers to the variety of living organisms present on Earth, including the genetic,…
Q: DNA synthesis
A: DNA: It is deoxyribonucleic acid which is a double-stranded nucleic acid which contains genetic…
Q: LO23 Explain the concept of cytoplasmic inheritance Which of the patterns of phenotypes would we…
A: Cytoplasmic inheritance, also known as maternal inheritance, is a type of inheritance pattern where…
Q: Identify the base labeled B. cytosine thymine O adenine O guanine A C B D
A: Nucleotides are the building blocks of DNA and RNA. Nucleotide is composed of a sugar, phosphate and…
Q: Which of the following is NOT correct about programmed cell death? O Apoptosis is mediated by RIPK3…
A: Cell death is the process by which a cell ceases to live and function. There are two main types of…
Q: How an algal cell is different from fungal cells, even if both are eukaryotes? Why slime mold is a…
A: Algal cell is different from fungal cells:- Algal cells are different from fungal cells, even if…
Q: Discuss the following prompt: In this experiment, we are looking to see how much different…
A: Phaseolus vulgaris is the scientific name for the common bean, which is a species of legume widely…
Q: What new amino acids might be substituted for proline after treatment with 5-BUDR? (This mutagen…
A: Five Promo Russell is a mutagenic analogue of the mean that can incorporate into DNA during…
Q: a. Explain the meaning of mobile and immobile elements in relation to the development of deficiency…
A: Deficiency symptoms are the physical manifestations a plant makes when it is deficient in one or…
Q: Coding strand: Template strand: 5' AAGACCTATATAATGACGAACGATATT 3 3 TTCTGGATATATTACTGCTTGCTATAA 5
A: Transcription is the process that synthesis the mRNA transcript from the double-stranded DNA by the…
Q: Bile exits the gallbladder in the hepatic duct common bile duct cystic duct hepatopancreatic duct
A: A tiny organ beneath the liver called gallbladder is essential to the functioning of the digestive…
Q: Which of the following factors DOES NOT affect pluripotency? O DNA Acetylation Oct4 Nanog miRNA's…
A: Pluripotency is the ability of stem cells to differentiate into all the cell types of an organism.…
Q: How does the activity of the sodium-potassium antiport pump contribute to an overall negative…
A: The sodium-potassium antiport pump is a transmembrane protein that is found in the plasma membrane…
Q: 1. Suppose a child was found to have the chromosome pattern shown in Figure 1 above. a. Is the child…
A: Karyotype is a total collection of the chromosomes of a organism. For suppose the karytope of humans…
Q: Arrange the following four events in an order that explains the mass flow of materials in the…
A: Transportation in plants refers to the movement of water, minerals, and other substances from the…
Q: A researcher discovers a mutation in the promoter region of a gene that increases the rate of…
A: A mutation is a change in the genetic information (DNA sequence) of an organism. This change can…
Q: WHICH OF THE FOLLOWING STATEMENTS IS CONSISTENT WITH THE RESULTS OF THE EXPERIMENT?…
A: ATP or Adenosine Triphosphate is the principal energy source of the cell. The ATP molecule contains…
Q: In regard to the wobble hypothesis and the fact that cells do not need a full complement of tRNAs…
A: The wobble hypothesis, proposed by Francis Crick, describes how the third nucleotide in a codon (in…
Q: What is the difference between anabolism and catabolism
A: Metabolism is the process by which various chemical processes take place in an organism or a cell.…
Q: During the cycling of neurotransmitters in the axon termini, the fusion of the neurotransmitter…
A: When an action potential arrives at the axon terminal it triggers the opening of voltage gated Ca2+…
Q: Fructose is not the starting material for the production of high fructose corn syrup. is made in the…
A: Fructose is a simple sugar, also known as a monosaccharide, that is naturally present in many…
Q: Part C Using the table as a guide, research and evaluate two forms of renewable energy. Use reliable…
A: Those sources of energy which are not based on the burning of fossil fuels are called renewable…
Q: What is parsimony? an element that decays from antimony, used for radiometric data of fossils. a way…
A: A branching diagram or "tree" illustrating the evolutionary links between several biological species…
Q: what ribosome channels accept charged tRNA molecules?
A: Large macromolecular structures known as ribosomes are present in every live cell. They are…
Q: Station #l: Passive Transport 1. Passive transport = Examples) a. b. Station #2: Active Transport 2.…
A: Cell membranes separate the inside of the cell from its surrounding environment. Cell transport is…
Q: Give typing answer with explanation and conclusion Negative chemotaxis in migrating neural crest…
A: Neural crest is a group of cells that form along the neural tube during early embryonic development…
Q: Measure the migration of each band in the marker lane from the well. Using a semi-log scale, plot…
A: Electrophoresis is defined as the migration of charged particles under the influence of an electric…
Q: What is the co-transduction index of histidine and tyrosine, standardized on tyrosine? Recipient…
A: The co-transduction index of histidine and tyrosine, standardized on tyrosine, can be calculated as…
Q: What is true regarding the importance of the R groups of amino acids in protein structure? Check all…
A: Biomolecules are complex substances that are involved in biological activities. There are mainly…
Step by step
Solved in 4 steps
- 6. Which of the following is not used as evidence of evolution? a. Biogeography b. DNA Sequences c. Folktales d. FOSSIL RECORDS 8. Which of the following is are analogous structures? a. The leg of a dog and flipper of a dolphin b. The limbs of humans and apes c. The wings of bats and butterfly d. The tales of mice and rats 9. Which of the following is true about vestigial structure or trait? a. These structures are highly developed especially for modern species b. It has an important function in both more highly evolved and more ancestral organisms c. It last not have a necessary function in more highly evolved organisms but it did in more ancestral organism d. It did not have a necessary function and more ancestral organism but it does in more highly evolved organisms 10. What do the structural similarities between the flippers of wheels in the arms of human suggest a. Humans and wheels have common ancestor b. The human species began life in the ocean c. Wheels are older than…1. Process of adaptation is one of the keys toward survival of species. Which of the following is NOT an example of adaptation? A. Dying out of dinosaurs during cretaceous period. B. Certain group of birds eating different kinds of food. C. The finches of Galapagos with different beaks. D. A child learning to walk on his own. 2. Why do organisms with close biochemical similarities show stronger evolutionary relationships? A. They have varied and different ancestry B. They have similar patterns during early stages of development C. They have common ancestor and have the same kind of proteins D. They possess same vestigial structure that made their evolutionary relationship closer. 3. Where do most fossils be found? A. Sedimentary rocks C. Lava flow B. Granite rocks D. Black soil 4. What is the best statement to supports the idea that extinction is necessary? A. To give way for organisms to develop B. To let other organisms evolve and progress…17. Which of the following statements best explains the Theory of Natural Selection? * a. Organs that are not used may disappear, while organs that are constantly used may develop b. In nature, the organism with desirable characteristics may survive, while those weaker traits may not c. Organisms develop desirable structures to survive in a given environment d. Acquired characteristics of parents can be passed on to offspring 18. Larry Daley is a paleontologist found out some Central American Acacia species that have hollow thorns and pores at the bases of their leaves that secrete nectar. He used the species to understand the history and origin of the place. From the given situation, the Central American Acacia species is an example of _____________. * a. evolution b. fossil c. mutation d. coevolution
- 5. Identify one species shown in the diagram that has become extinct. State how you were able to tell it is extinct based on the evolutionary tree.11. It is the type of evolution when species shares a common ancestor but live in different places. a.) Convergent Evolution b.) Divergent Evolution c.) Parallel Evolution d.) Vertical Evolution 12. Which Statements explains the effect of environmental changes in the evolution of long neck giraffe? a.) early giraffe naturally have long neck b.) Because of the need to survive they kept stretching their necks until these became longer and able to reach taller trees. c.) all short neck giraffe died because of food shortage d.) when long and short neck giraffe were crossed,only the long traits are passed on to the offspring 13. Which homologous structure is incorrect? a.) Bat Wing: Butterfly Wing b.) Human Arm: Whale Flipper c.) Human Arm: Alligator Forelimb d.) Bird Wing: Alligator Forelimb 14. Front limbs of man, cat horse, bat, whales, and other mammals are made up of same kind of bones. In what ways are they different? a.) Development b.) Structure c.) Parts d.) Size and…11. Which of the following is NOT true: A. natural selection should favor the weeding out of harmful genes B. If changes to the DNA do not alter a gene's protein, they are more likey to get weeded out C. Scientists still aren't sure how DNA sequences results in a four dimensional animal D. There are more mutations and genetic differences between species BETWEEN genes than WITHIN genes 12.Whose discovery made the dating of ancient materials possible? A. Charles Darwin B. Francis Crick C. Marie Curie D. Gregor Mendel E. William Paley 13. Charles Darwin is responsible for discovering which of the following: A. the laws of inheritance B. the theory of natural selection C. the classification of living organisms D. all of the above 14. Sometimes a species' trait is not actually an adaptation because: A. it result from other properties B. hitchhiker effect C. it is an exaptation D. all of these 15. The subfield of biological anthropology that studies human skeletal remains and materials found…
- 2. Jeąn-Baptiste Lamarck's explanation for the evolution of long-necked giraffes from shorter- neckêd okapi-like ancestors on a savanna would include all of the following features except: A. over time, inheritance of acquired characteristics in okapis would lead to savanna giraffes B. once an okapi had acquired a longer neck, it could pass on this new trait to its offspring C. okapis in a savanna habitat found it advantageous to stretch their necks for treetop leaves D. each individual okapi could increase its neck-length by deliberate, consistent exercise E. only those okapis with favorable traits (long necks) could be ancestral to savanna giraffes3. What evidence is present when DNA, gene codes and expressions, as well as amino acids are basically shared by related species at the most basic level? A. Fossil evidence B. Genetic evidence C. Embryonic development evidence D. Comparative anatomy evidence 4. Which of the following statements is correct in terms of amino acid sequence? A. The greater the differences in the amino acid sequence of two species compared, the more related the species are. B. The lesser the differences in the amino acid sequence of two species compared, the more related the species are. C. When the amino acid sequence of two species compared is just the same, the more related the species are. D. None of the choices 5. Which of the following species, is closely related to human beings according to similarity of the number of amino acids and their location? A. horse C. chimpanzee D. rhesus monkey B. gorilla1. Which among the following is NOT a principle of natural selection? a. The DNA sequence of the organism will change. b. The characteristics of organisms are inherited or passed from parent to offspring. c. Offspring vary among each other about their characteristics, and those variations are inherited. d. More offspring are produced than can survive. 2. Tawilis is a freshwater sardine endemic only in the Taal Lake in Batangas province. After several eruptions of the Taal volcano in the 21st century, the sardine population mentioned above rapidly dropped up to 82%. What best describe this scenario? a. mutation b. migration c. natural selection d. genetic drift
- 3. Linear evolution suggests that there is a ladder, or step- progression, to evolution over time -- one species building and transitioning into another species. A bushy interpretation of evolution suggests multiple overlapping species of hominins, with some species short-lived, and others existing for a long period of time. What type of evolutionary model does A. sediba support? Explain your answer.2. Birds have evolved over the last 60-70 MY. To learn about their relatedness, we can use DNA sequences. Because DNA evolves at a relatively steady rate, gene sequences in two different organisms will accumulate sequence changes and become more different with time. The longer ago their common ancestor was, the more different their sequences will be. However, some genes are under more selection and so evolve slowly. Other genes are under less selection and so evolve quite quickly. Assuming that sites change linearly with time, we can calculate how many sites differ when comparing genes between different species. For simplicity we'll assume we are comparing 1000bp of sequence for each of these genes. Species compared Canary and olive finch Canary and house finch Canary and zebra finch Canary and robin Canary and chicken a. Why do the three genes differ in the number of variable sites between different species? Canary Olive finch House finch Zebra finch robin chicken Canary # of sites…9. Which of the following statements best explains the Theory of Natural Selection? * A. Organs that are not used may disappear, while organs that are constantly used may develop B. In nature, the organism with desirable characteristics may survive, while those weaker traits may not C. Organisms develop desirable structures to survive in a given environment D. Acquired characteristics of parents can be passed on to offspring 10. Which of the following statements explains Lamarck’s Theory of Use and Disuse? * A. Body structures develop because they are used extensively B. Body structures develop because they are not use C. Body structures develop because of competition D. Body structures develop because of mutation