Which of the following statements concerning glycolysis is incorrect? Group of answer choices It is an oxidation process in which no molecular oxygen is used. All reactions take place in the cytosol of a cell. There are two stages, each of which involves a series of five reactions. No correct response.
Q: Food Sample marshmallows Pumpkin seeds cracker Dried cranberries рорсorn Rice cake almond
A: Calorific value of foods is based on their nutrient content. Calorific value of foods is the total…
Q: Using the concept of complementary base pairing, write the complementary DNA strands, with their 5'…
A: The DNA molecule generally has two strands that wind around one another to form a shape is generally…
Q: How many FADH2 and NADH molecules get produced by beta oxidation of palmitic acid (a 16 carbon fatty…
A: Beta oxidation is a process of breakdown of fatty acid molecules by breaking the bond between beta…
Q: Which of the following are proper disinfection steps? Check all the O Remove organic matter O…
A: Introduction: Disinfection is substances that are applied to non-living objects to destroy…
Q: Calculate the standard free-energy change, deltaG'o, for the reaction in which acetaldehyde is…
A: NADH is used as the biological electron carrier and is used for the reduction of Acetaldehyde in…
Q: 3. Identify if the following is a pyrimidine/purine nucleotide or a pyrimidine/purine nucleoside and…
A: Hi, Thankyou for posting your question on Bartleby. As per the guidelines we are allowed to answer…
Q: In Metabolic Pathways, what are the nucleotide-containing compounds?
A: A nucleotide mainly consists of a sugar molecule that is either ribose in RNA or deoxyribose in DNA…
Q: You are analyzing the peptide ala-ile-glu-lys-phe-val- tyr-cys. If you treat the peptide with…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…
Q: Which of the following statements is CORRECT regarding the following intermediate? H2N H NH2
A: "Since you have asked multiple questions, we will solve the first question for you. If you want a…
Q: 18:1c∆9 ω-9 fatty acid oleic acid both are correct neither is correct
A: In plants, animals, and microbes, fatty acid is a key component of lipids (fat-soluble components of…
Q: The following statements are TRUE regarding carbohydrates, EXCEPT: Carbohydrates are the most…
A: Introduction: Carbohydrates are polyhydroxy aldehydes or polyhydroxy ketones with a general formula…
Q: Where does molecular oxygen (O2) get generated during photo-phosphorylation? Photosystem I 2…
A: The light reaction, also known as photolysis reaction, occurs in the presence of light. It mainly…
Q: What is the terminal electron acceptor in photo- phosphorylation?
A: By activating PSII, photophosphorylation converts ADP into ATP using the energy of sunlight. It…
Q: Match the following descriptions to the given choices. A. Aldosterone The first molecule in the…
A: 1. The first molecule in the biosynthesis of steroids that contain the…
Q: Promote platelet aggregation and smooth muscle contraction…
A: PGH2 : Prostaglandin H2 TxB2 - Thromboxane B2
Q: By chemical structure, urethanes include: A. Nialamid B. Parmidin C. Picamilon D. Isoniazid E.…
A: Urethane is also called as Ethyl carbamate or Ethylurethane. It is used as a antineoplastic agent.…
Q: Using DEAE-cellulose as ion exhange resin, indicate the starting and ending pH for the narrowest…
A: Ion exchange chromatography is used to separate the charged molecules such as amino acids and…
Q: Describe three important health disorders or diseases related to abnormal cholesterol metabolism
A: Cholesterol is a class of certain organic molecules which is found in the body of living organisms.…
Q: The parasite Trypanosoma brucei, which causes sleeping sickness, uses proline as an energy source…
A: A transport mechanism that works to facilitate the movement of substances in and out of the cell…
Q: 1. Is the Homo sapiens phenylalanine hydroxylase (PAH) gene encoding a non-coding protein or an…
A: Phenyl alanine hydroxylase is an enzyme that causes phenylketonuria on its deficiency. Phenyl…
Q: 4
A: The general mechanism is the reversible inhibition that takes place due to the formation of…
Q: Hormones, such as testosterone, estradiol and progesterone are examples of steroidal lipids. O True…
A: Leydig cells secrets testosterone in male body. In female body ,granulose cells of the ovaries…
Q: Now let us look at a real amino acid, alanine. Fill in the chart below for each ionizable group. You…
A: Amino acids are the building block of proteins. Amino acids are consisted of carboxyl group, amine…
Q: Only one of the statements below is correct; which one? O Two solutions are hypotonic when they have…
A: Tonicity is a parameter of the effective osmotic pressure gradient, which is the difference in water…
Q: Explain which of the following substances ATP, CoA-SH, FAD and NAD+ have the subunits in their…
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotides is an…
Q: Both reducing monosaccharide and disaccharide give positive result in Barfoed's test. Which of the…
A: Barfoed's test is done to differentiate between monosaccharide and disaccharide.
Q: When is it appropriate for gloves to be worn? Check all that apply. O Only if you have.time O Only…
A: As part of standard precautions to reduce the risk of contamination for health care providers, the…
Q: Compare the net production of ATP from four molecules of glucose (4 x C6) with that from one…
A: Glucose is oxidized through glycolysis, pyruvate dehydrogenase reaction, and the TCA cycle into…
Q: Describe how you would make 10mls of a solution with concentration: 10mM Glucose (MW-180.16g/mole)…
A: In a solution concentration of solute is reduced simply by mixing more water or by adding more…
Q: The free energy of folding of a protein is -17kJ/mol. What tenoerature (C) do you have to heat the…
A: Protein folding is related to protein stability that is the thermodynamic stability, not the…
Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA
Q: malate + NAD+ oxaloacetate + NADH + H+ If the pH = 7 and [malate] = 0.0010 M, [oxaloacetate] =…
A: Malate + NAD+ →Malate dehydrogenase Oxaloacetate + NADH + H+ Above reaction is the last step of…
Q: 1. A nucleoside is composed of Sugar and Nucleic Acid-Base. 2. The Nucleic Acid base in DNA and RNA…
A: Statement 1 is FALSE. BECAUSE NUCLEOSIDE IS COMPOSED OF NIYROGEN BASE+ PENTOSE SUGAR, NOT THE…
Q: what is the importance of studying the variety, sequences, and amounts of mRNA produced in the cell?
A: The genes in DNA encode protein molecules, which serve as the cell's "workhorses," performing all of…
Q: COMPLETE THE TABLE OF 10 STEP OF GLYCOLYSIS BY REFERRING TO THE GLYCOLYSIS PATHWAY
A: The chemica; interconversion steps, that is the sequence of reaction by which glucose is converted…
Q: 4. Complete the table below: RNA DNA Strand Sugar residue Nitrogenous bases Main Function
A: Nucleic acids are made up of nucleotides, which are the fundamental building blocks of DNA and RNA.…
Q: Which of the following is TRUE concerning the induced fit model of enzyme catalysis? * (One correct…
A: Induced fit model: this theory explains that the active site of an enzyme is so flexible that…
Q: Section B: True / False (5 marks) 1. Primase has a DNA dependent RNA polymerase activity. 2.…
A: True or false statement Primase is a kind of RNA polymerase that is involved in the replication of…
Q: structures of 2 complex lipids (a) a glycolipid and (b) a sphingolipid. Would either of these…
A: Molybdate solution test: First we need to know what is molybdates solution, and how it works?…
Q: Which of the following statements are correct about how the complex biological matrix of the cell…
A: cell matrix or the cytosol is the fluid component of the cell which contains many organelle that…
Q: How should you prepare your running buffer?
A: SDS-PAGE is method of separation of protein based on its size. Running buffer of the SDS-PAGE…
Q: A recent genome sequencing project for the bacterium Burkholderia mallei has identified a new…
A: The new protein identified here has a partial sequence given as TVEVNAPGDVQKALSELQQINDGRLDIRI…
Q: Explain the four stages of biochemical energy production from food which are part of the typical…
A: The which we consume is composed of nutrients like carbohydrates, proteins, and lipids. After…
Q: How are water-soluble vitamins different from fat-soluble? * (Please choose one correct answer only)…
A: Vitamins are essential nutrients required for the body to fight against diseases. There are two…
Q: O antigen is a base oligosaccharide that is present in both A and B antigen. O True O False
A: The four blood types found in humans are A, B, AB, and O. Before undergoing a blood transfusion,…
Q: For the electron transport chain, all are inhibitors except: Select one: O a. Antimycin A O b.…
A: Most of the free energy released during the oxidation of glucose to carbon dioxide is retained in…
Q: temperature of 15 degree Celsius or lower needed for growth / optimal activity. * (Please choose one…
A: A) Thermophiles: Thermo meaning temperature and philus meaning lover , this type of organism which…
Q: Question 3 N-glycosyltransferase attaches which sugar to the base oligosaccharide to synthesize the…
A: A antigen is the antigen that is important for blood grouping of individuals. Antigen A and Antibody…
Q: A physician diagnoses an infant patient with a pyruvate carboxylase deficiency in part by measuring…
A: In case of Pyruvate Carboxylase deficiency, body accumulates lactic acid in blood. This is an…
Q: A. Name the two proteins that induce a negative feedback in this pathway and explain why both…
A: Since, you have posted multiple questions we will solve the first question for you. If you want any…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The oxidation of sugar molecules by the cell takes place according to the general reaction C6H12O6 (glucose) + 6O2 → 6CO2 + 6H2O + energy. which of the following statements are correct? explain your answers. all of the energy produced is in the form of heat. none of the produced energy is in the form of heat. The energy is produced by a process that involves the oxidation of carbon atoms. The reaction supplies the cell with essential water. in cells, the reaction takes place in more than one step. many steps in the oxidation of sugar molecules involve reaction with oxygen gas. some organisms carry out the reverse reaction. some cells that grow in the absence of O2 produce CO2.Which of the following are true statements regarding cellular respiration? (Select all that apply) Group of answer choices Lactic acid fermentation is an aerobic process The final electron acceptor in the electron transport chain is oxygen Two ATP are produced in the citric acid cycle Glycolysis produces two net molecules of ATP Four ATP are produced in the Krebs cycleWhich of the following statements about glycolysis is FALSE? O It generates 2 molecules of ATP net per molecule of glucose. O It is located in the cytosol of both prokaryotes and eukaryotes. O It requires an input of 2 molecules of ATP per molecule of glucose to generate fructose-1,6-bisphosphate. O It generates 2 molecules of NADH per molecule of glucose. O It liberates 2 molecules of CO2 per molecule of glucose.
- The phosphorylase enzymes that reverse steps 1 and 3 of glycolysis, are what type of enzyme? Group of answer choices ligase isomerase transferase hydrolase oxidoreductase lyaseCellular respiration is an important process in providing energy for cellular works. Which of the following process produce the most energy in the form of ATP during cellular respiration? Glycolysis Oxidative phosphorylation Substrate-level phosphorylation Citric acid cycleCyanide poisoning inhibits aerobic respiration at cytochrome c oxidase. Which of the following is NOT a result of cyanide poisoning at the cellular level? Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a b с d e Oxygen is reduced to water The rate of glycolysis increases Cells are forced to switch to anaerobic respiration The electron transport chain is not completed None of the above Answered K Open in Reading View ✔Posubmit
- Several of the enzymes of glycolysis fall into classes that often occurs in metabolism. Describe ONLY ONE reaction types are catalzed by each of the following. Kinasesn Glycolysis and the Krebs's cycle are shut down due to the buildup of specific substrates like ATP and te, this is called: ompetitive Inhibition losteric activation eedback Inhibition etabolism overloadWhich of the following processes will result in a direct net increase of ATP concentration? Group of answer choices Anabolic chemical pathways Primary Active transport dehydration synthesis Glycolysis
- All of the following are true statements concerning glycolysis EXCEPT: It occurs in the cytoplasm of the cell. It uses, as well as produces, ATP It produces ATP by oxidative phosphorylation. It involves the conversion of a molecule of glucose into two molecules of pyruvic acid. It is also called the Embden-Meyerhof pathway. Question 20In which of the following processes is glucose 6-phosphate the end product? Group of answer choices glycogenesis glycogenolysis glycolysis more than one correct responseWhich of the following enzyme catalyzes the first step of glycolysis? Group of answer choices Hexokinase Pyruvate kinase Glucokinase Phosphofructokinase