1. Is the Homo sapiens phenylalanine hydroxylase (PAH) gene encoding a non-coding protein or an enzyme? What function does this protein serve? If necessary, you may include a mechanism.
Q: Explain the 4 roles of enzymes thereby lowering the activation energy
A: An enzyme, by definition, is a protein molecule that acts as a biological catalyst, allowing…
Q: Evaluate the line depicted by line B, presence of. ... A B C Substrate concentration competitive…
A: The plot of velocity and substrate concentration of an enzyme-catalyzed reaction gives a hyperbolic…
Q: write about a Famous Case of someone with Li-Fraumeni Syndrome
A: Li-Fraumeni syndrome is a rare hereditary disorder that predisposes carriers to cancer development.…
Q: What are the biochemical test used to assay fatty acids and cholesterol?
A: Fatty acids are carboxylic acid derivative of aliphatic chain hydrocarbon. It can have long or short…
Q: Briefly describe four ways in which a protein could be denatured.
A: The highly organized structures of proteins are true works of chemical architecture. Denaturation…
Q: 4. A solution containing egg albumin (pl-4.6), B-lactoglobulin (pl-5.2), and chymotrypsinogen…
A: Based on their isoelectric point, protein purification can be done in an ion-exchange column (pI).…
Q: Begining with 1 M concentrations of each reactant and product at pH=7 and 25.0 degrees C, calculate…
A: As given in the question, the concentration of each reactant, i.e., Pyruvate and NADH, and products,…
Q: Suppose you want to determine if excessive lipid ingestion altersgene transcription. Describe and…
A: Dietary fat is a crucial macronutrient for the increase and development of all organisms. In…
Q: 10. The degree of unsaturation of lipid can be measured as A. saponification number B. iodine number…
A: Saturated fats are the fatty acids in which the hydrocarbon chain with a carboxyl group contains…
Q: What glycolytic intermediate does glycogenolysis produce? Explain in brief..
A: Glycolysis is a metabolic pathway in which glucose is converted to pyruvate. The principal sugars…
Q: Why does it make sense that under conditions of low ATP levels in the cell the pyruvate carboxylase…
A: Reaction catalyzed by Pyruvate carboxylase is given below; Pyruvate + CO2 + ATP + H2O →Pyruvate…
Q: Match lipid descriptions in column A with the phospholipid types in column B. H is attached to the…
A: Phospholipids have a glycerol backbone and are the major constituents of the cell membrane.
Q: In Table 13-1, what is the most common function of proteins that contribute to pattern formation?…
A: Drosophila melanogaster, a fruit fly, is utilised as a model organism in research spanning from…
Q: 1. A sigmoidal plot of substrate concentration ([S]) verses reaction velocity (V) may indicate: (A)…
A: Hi. Thank you for the question. As per the honor code, We are allowed to answer three sub-parts at a…
Q: H3C H3C. HyC O Triglyceride O Fatty acid Glycerol
A: Fatty acids are important micromolecules which combine together to form lipids in plants, animals…
Q: Explain how Allopurinol works to decrease Uric Acid excretion. (I
A: Allopurinol is a class of medications called xanthine oxidase inhibitors and is used to prevent or…
Q: Explain the role of CDK inhibitors. If cyclin-CDK complexes are necessary to allow regulated…
A: Cyclin-structured kinases (CDKs) were considered promising drug targets for some years, however,…
Q: Some of the following four amino acids : alanine, arginine, histidine, aspartic acid would provide a…
A: Introduction: Acid-base catalysis is a mechanism in which the transfer of a proton from an acid…
Q: OH HO NH2 O Cceramide O Sphingosine O Globoside O sphingomyelin
A: Lipid metabolism is the synthesis and degradation of lipids in cells, which includes the breakdown…
Q: Urease enzyme hydrolysed urea at [S]= 0.03 mmol/L with a Km value of around 0.06 mmol/L. The initial…
A: Vmax is the reaction's maximum speed at which all of the enzymes become saturated with the…
Q: Given the Following DNA template, TAC CGC TCC GCC GTC GAC AAT ACC ACT, write out the…
A: The DNA template is used for the synthesis of mRNA molecules. mRNA molecule is used by the…
Q: When the blood glucose is low, insulin is released from the pancreas to maintain glucose…
A: Introduction: Homeostasis is the maintenance of a stable internal environment within an organism,…
Q: Below are the structures of three phosphate-containing molecules. Which one has the lowest…
A: Phosphate group is containing one phosphate group atom attached to four oxygen molecule.Various…
Q: One of the major problems in food chemistry is to make food gels maintain its shape and rigidity.…
A: Carrageenan are polysaccharides comprised of repeating disaccharide units of sulfate derivatives of…
Q: QUESTION; — Compare and contrast the degradation pathways of purines and pyrimidines, making sure to…
A: Nucleotides are used in nucleic acid synthesis, intermediate metabolic processes, and the breakdown…
Q: These are enzymes that can sustain in a high hydrostatic pressure. * (Please choose one correct…
A: Bacteria are classified into different classes based on the influence of different environmental…
Q: Given the following reaction, identify the class and subclass of the enzyme involved. CH,OPO,2-…
A: Enzymes are biocatalysts that speed up biochemical reactions. These are mainly three dimensional…
Q: Transcription in eukaryotic cells which is resistant to α-amanitin is carried out by which RNA…
A: RNA ploymerase arr the enzymes that synthesize RNA by reading the DNA strand. It copies DNA sequence…
Q: Match lipid structures in column A with its lipid type in column B esters of fatty acids with long…
A: The question include match the following with different options. The correct options are mentioned…
Q: TRUE OR FALSE 1. In the structure of Aztreonam, addition of a moiety capable of Van de Waals…
A: Aztreonam is an antibiotic like penicillin and it inhibits the peptidoglycan crosslinking enzyme…
Q: What carbohydrate is generally detected using the Molisch test? *
A: Carbohydrates are polyhydroxy aldehydes or ketones commonly called as sugars or saccharides.…
Q: I want a solution that is 1/10th the strength of my stock solution. I want 20 microliters of total…
A: A solution can be diluted to the desired concentration by using the formula C1V1=C2V2 Where C1=…
Q: COMPLETE THE TABLE OF 10 STEP OF GLYCOLYSIS BY REFERRING TO THE GLYCOLYSIS PATHWAY
A: The chemica; interconversion steps, that is the sequence of reaction by which glucose is converted…
Q: Give the names of the 20 Common Amino Acids and draw the structure of each.
A: Any organic molecule that consists of a basic amino group, an acidic carboxyl group, and a distinct…
Q: Promote platelet aggregation and smooth muscle contraction…
A: PGH2 : Prostaglandin H2 TxB2 - Thromboxane B2
Q: Under what conditions will lactic acid accumulate in skeletal muscle? Select one: A. When NADH is…
A: A reduction in muscle force generated over time or as a result of pathological conditions is…
Q: ODD MAN OUT. Which of the following is not related to the other choices below? adenylyl cyclase…
A: Signaling is the process of communication between the cells, and between the cells and the…
Q: Arrange signalling cascade events in chronological order.…
A: Signaling pathways helps to respond the cells according to the external stimuli. The external…
Q: Give 5 examples of molybdenum complexes. State their physical and chemical properties and their…
A: The atomic number of molybdenum is 42 and it is represented by the symbol 'Mo'. On the earth,…
Q: Identify the dependent variable in the experiment whose data are graphed in Figure 2. Identify the…
A: Caspases are a type of protease enzyme that plays an important part in programmed cell death.…
Q: 1) Below you are given the structures of the disaccharides lactose and trehalose. но OH OH OH но но…
A: Lets first assume that all the carbohydrates given here are D isomers , cause that the general case…
Q: Acetyt CoA Oxaloscetate CoA NADH Citrate NAD Isocitrate Malste Pumarate NAD NADH FADH, FAD a-…
A: TCA cycle is the tricarboxylic acid cycle which is second step in cellular respiration that occurs…
Q: ceramide with a single sugar is called? Cerebroside Plasmalogen Sphingomyelin…
A: sphingolipids : found in brain extract, contain a backbone of sphingoid bases, a set of organic…
Q: LIPIDS Functions Chemical Components 1. 1. 2. Two Primary Categories of Lipids 2. 3. 3 4. Two…
A: Functions of lipids: 1. Storage of energy 2. Transmit nerve impulses 3. Structure of cell membranes…
Q: Choose among proteins A, B, C, and D. 1. Protein that will most strongly bind to an anion exchange…
A: Chromatographic techniques are used to separate specific molecules from a mixture of different…
Q: Transcription of a typical gene encoding a polypeptide in eukaryotes involves all of the following…
A: In eukaryotes, the genomic DNA is present in the nucleus. The process of transcription in the case…
Q: SDS-PAGE reagents that play a role in denaturing the protein sample include (Select all that…
A: Proteins are present in their globular structure till they don't get denatured by something…
Q: Substrate A occupies the active site of an enzyme. However, inhibitor XY occupies a region in the…
A: Enzymes are catalyst which only accelarate the reactions but doesn't take part in reaction. So after…
Q: Question 20 он NH но HO" "он cerebroside monoglycosyl ceramide glycosphingolipid O all are correct
A: Phospholipids are compound lipids composed of fatty acids, alcohol, and an additional group. Based…
Q: 1) Based on the composition of fatty acids present in each TAG , predict which TAG (X, Y or Z)has…
A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- 1. A monogenic disease is a disease caused by a mutation in a single gene. For instance, sickle-cell anemia is caused by a mutation in the HBB gene, which codes for the B- globin chain of hemoglobin. The beginning of HBB is shown here: 5'-ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACT...-3' A. Translate this HBB sequence into an amino acid sequence. B. In terms of amino acids, what is the result of the sickle cell mutation, wherein the bolded red A is changed to a T? This single mutation causes hemoglobin to aggregate, causing red blood cells to deform into a sickle-like shape rather than the normal “biconcave disk" shape. C. What would happen if the bolded blue A were mutated to at T? (This is hypothetical; it's not a mutation found in sickle-cell disease.)1). In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the brain, resulting in seizures, blindness, decline in cognitive function and motor skills, dementia, and death by the late teens or early 20’s. The TPP1 gene is 6695 bp in length. Think about the characteristics of Batten disease, and then suggest an approach to gene therapy that might be effective for this specific genetic disorder. You may assume that your research team is working in the U.S. and your research is funded by a grant from the National Institutes of Health (NIH). Please EXCLUDE the use of CRISPR from consideration. A. Will you use germline or somatic cell gene therapy? Please NAME and DEFINE the form of gene therapy selected, then explain WHY this is the most appropriate choice.1). In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the brain, resulting in seizures, blindness, decline in cognitive function and motor skills, dementia, and death by the late teens or early 20’s. The TPP1 gene is 6695 bp in length. Think about the characteristics of Batten disease, and then suggest an approach to gene therapy that might be effective for this specific genetic disorder. You may assume that your research team is working in the U.S. and your research is funded by a grant from the National Institutes of Health (NIH). Other scientists have suggested that it might be possible to use CRISPR to treat this genetic disorder in affected individuals. (i) First, what is CRISPR? (BRIEFLY describe what it is and how it works). (ii) Briefly describe how CRISPR could be utilized in treating genetic conditions such as Batten disease.
- 1). In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the brain, resulting in seizures, blindness, decline in cognitive function and motor skills, dementia, and death by the late teens or early 20’s. The TPP1 gene is 6695 bp in length. Think about the characteristics of Batten disease, and then suggest an approach to gene therapy that might be effective for this specific genetic disorder. You may assume that your research team is working in the U.S. and your research is funded by a grant from the National Institutes of Health (NIH). a) Hypothetically, what specific type of VECTOR will you use to perform your gene therapy? Please select from the following list of potential vectors: disabled retrovirus, adenovirus, adeno-associated virus (AAV), or herpes simplex virus (HSV), then give two reasons why this specific vector is the most appropriate for your gene therapy. Please explain why you were able to rule out the other potential…1. How would the following affect BOTH transcription and translation of a particular multi- exon gene in a eukaryotic cell (for each address both transcription and translation of a particular multi-exan gene; also treat each independently): A mutation abolishing kinase activity in TFIIH a. b. A mutation abolishing mRNA binding in the snRNP U1 С. A mutation in aminoacyl tRNA synthetase for isoleucine such that it can't bind ATP (assume there is an isoleucine in the code)1. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 3’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 5’ a. What is the amino acid sequence based on this mRNA? b. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?
- 6. Similar to the class notes (Intro to Genetics), a segment of DNA (shown below) contains a promoter segment (the first 9 base pairs), a ribosome binding segment (the next 6 base pairs), and a segment that codes for protein synthesis which is started by the rest of the base pairs. ACTCCATTGAACCATTTCTATGATCCGCTAACG-... TGAGGTAACTTGGTAAAGATACTAGGCGATTGC-... A. When the DNA is induced to be copied to mRNA, the top strand is coding, meaning that the mRNA makes an identical copy of the lower strand (replacing T with U) The mRNA copy starts with the ribosome binding sequence. What is the sequence of the mRNA that will go to the ribosomes? B. What are the first 6 amino acids of the protein that are coded for by the mRNA? C. What would the amino acid sequence be if... i. a transition mutation occurred on the final G in the mRNA? ii. all of the G & C bases in the protein synthesis portion had transition mutations? iii. a point deletion mutation occurred in the ATA sequence (in the lower strand…1. A DNA base sequence transcribed into messenger RNA in the following sequence: TTATCTTCGGGAGAGAAAACA. a. If you read from left to right, what amino acids are coded by this sequence? (Note: The initiation sequence is disregarded in this example.) b. If proflavine treatment caused the deletion of the first adenine nucleotide on the left, describe the changes that would occur in the first six amino acids coded by this sequence?1.List three different mRNA sequences that could encode the amino acid sequence histidyl-alanyl-arginyl-seryl-leucyl-valyl-cysteine.
- (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAAGGACGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Arg Thr Val) (b.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGGAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCCUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Pro Leu Gly Thr Val) (c.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCTCAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGAGUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Ser Leu Gly Thr Val) (d.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATCCCTCCAT 3¹ Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAGGGAGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Gly Arg).As the last sequence contains only 2 bases it will not represent any amino acid. question: Choose the types of mutations caused by the changes in parts…1. List three different mRNA sequences that could encode the amino acid sequence histidyl-alanyl-arginyl-seryl-leucyl-valyl-cysteine. 2. Write a DNA sequence that would encode the amino acid sequence valyl-tryptophanyl-lysyl-prolyl-phenylalanyl-threonine. 3. Titin is a muscle protein named for its size. Its gene has the largest known coding sequence of 80,781 DNA bases. How many amino acids long is it? 4. The human genome sequence encodes many more mRNA transcripts than there are genes. Why isn’t the number the same? 5. Locate as accurately as possible the listed items that are shown on the following figure. Some items are not shown. (a) 5′ end of DNA template strand; (b) 3′ end of mRNA; (c) ribosome; (d) promoter; (e) codon; (f) an amino acid; (g) DNA polymerase; (h) 5′ UTR; (i) centromere; (j) intron; (k) anticodon; (l) N terminus; (m) 5′ end of charged tRNA; (n) RNA polymerase; (o) 3′ end of uncharged tRNA; (p) a nucleotide; (q) mRNA cap; (r) peptide bond; (s) P site; (t)…1.List three different mRNA sequences that could encode the amino acid sequence histidyl-alanyl-arginyl-seryl-leucyl-valyl-cysteine. 2.Write a DNA sequence that would encode the amino acid sequence valyl-tryptophanyl-lysyl-prolyl-phenylalanyl-threonine. 3.Titin is a muscle protein named for its size. Its gene has the largest known coding sequence of 80,781 DNA bases. How many amino acids long is it? 4.The human genome sequence encodes many more mRNA transcripts than there are genes. Why isn’t the number the same? 5.Locate as accurately as possible the listed items that are shown on the following figure. Some items are not shown. (a) 5′ end of DNA template strand; (b) 3′ end of mRNA; (c) ribosome; (d) promoter; (e) codon; (f) an amino acid; (g) DNA polymerase; (h) 5′ UTR; (i) centromere; (j) intron; (k) anticodon; (l) N terminus; (m) 5′ end of charged tRNA; (n) RNA polymerase; (o) 3′ end of uncharged tRNA; (p) a nucleotide; (q) mRNA cap; (r) peptide bond; (s) P site; (t) aminoacyl-tRNA…