Transfer RNA Selected answer will be automatically saved. For keyboard navigation, press up/down arrow keys to select an answer. is larger in size if the protein to be made is longer in amino acid sequence. b transfers amino acids from proteins to mRNA. C is a type of ribosome a e matches amino acids with the correct codon in the mRNA. is a nucleic acid that alone codes for the primary structure of protein.
Q: The structure of DNA provides a mechanism for storing and transmitting cellular information all are…
A: DNA's genetic code encodes the amino acid sequences required to generate a cell's proteins. A…
Q: Parent A CFTRwt CFTRG511D CFTRwt CFTRwt CFTRwt CFTR GST G511D Healthy Healthy CFTRwt CFTRAF508…
A: Cystic fibrosis occurs when there is a mutation in CFTR gene that forms CFTR ( cystic fibrosis…
Q: Wild type, rapid-cycling accessions of Arabidopsis, such as the Columbia (COL) lab line will flower…
A: Arabidopsis (rockcress) is a member of family in the Brassicaceae family. They are flowering plants…
Q: D3
A: Immunity is the resistance to disease. The two important components of immunity are innate and…
Q: Compare the plots of the transport rates for both conditions. What is most likely mechanism of…
A: Serotonin is a neurotransmitter that carries messages in the form of chemicals from one nerve cell…
Q: In the cardiac cycle, the occurrence of S, is most likely indicated at which of the following…
A: A test to assess the heart's electrical functioning is called an electrocardiogram, or ECG. The…
Q: he lower limit of detection of an EBV assay is 25 copies/mL. All controls were as expected, and the…
A: EBV assay is a common tool to measure the presence of the virus in clinical samples. The lower limit…
Q: During meiosis, does random assortment occur before or after crossing-over?
A: Meiosis is the cell division that includes meiosis I and meiosis II without any DNA replication…
Q: The diploid human genome comprises 6.4 x 109 bp and fits into a nucleus that is 6 µm in diameter. A.…
A: DNA The genetic material of the organism which carry information for proteins.
Q: Bacteriophage Lamda Describe what method use to retrieved gene of interest from the plaques.
A: So the lambda phage lacks a contractile tail, it is unable to 'push' its DNA through a bacterial…
Q: come up with two illustrations of objects that exhibit patterns in nature and write a brief 3-5…
A: Objects in nature often exhibit patterns. It helps us to see the world around us more clearly. Here…
Q: Which of the following is true about the organism which grew at both 37°C and 4°C in the figure…
A: The growth of the organism is very much confluent in 4oC and 37oC respectively.
Q: "Bacterial cells are often represented by the chemical formula C5H7NO2. Compute the theoretical…
A: The carbonaceous oxygen demand is also represented as the BOD or the biochemical oxygen demand from…
Q: 1. lodine test for Starch 2. Benedict's test for Sugar 3. Biuret test for Proteins 4. Grease Spot…
A: Introduction The word "macro" means large, so macromolecules refer to large molecules that are…
Q: 66 B 97 77 -Rab39 68 A Rab2 -Rab81.b 57 Rab@1.c Rab81.a 77 C Rabla DULE -Rab14 Rab4b ? F 93 87 D 100…
A: Rab proteins are termed Ras-associated binding proteins. They are membrane-bound proteins and belong…
Q: List the organizational levels of the human body
A: The complexity of different life forms can be explained by using different levels of body…
Q: 19. Using technical name, identify the microbe causing this infection 19
A: Infection is generally caused by bacteria and fungi. Infection is caused when microorganisms enter…
Q: #7
A: We know that Viruses are ultramicroscopic, noncellular infectious nucleo-proteins. Viruses inside a…
Q: Identify the blood vessels on a model or chart. Glomerulus Blood supply of the nephron 10 11 12
A: The kidney is a vital excretory organ because it helps to remove toxins, excess ions, and metabolic…
Q: motor neuron to the sarcolemma of the skeletal muscle fiber). Practice by drawing in circled numbers…
A: There are a few important points that should be kept in mind : In nerve and muscles cell, membrane…
Q: Are Viruses Living Organisms?What is your opionion of this topic
A: Microbiology is the science of microbes. Microorganisms aid in the creation of various foods,…
Q: Which molecule is believed to have preceded the other two during the evolution of life? RNA…
A: Introduction :- When an environmental shift makes new resources available or poses new environmental…
Q: The Pipidae are a family of tongueless frogs that have one or more claws on their toes. While…
A: Evolution can be described as a slow process of biological changes adapted and inherited by a…
Q: Describe and illustrate the parts of a phylogenetic tree.
A: A phylogenetic tree depicts the phylogeny, or evolutionary history of taxa. A phylogenetic tree is a…
Q: I need hand written solution
A: Global oxygen delivery (DO2) is the total amount of oxygen delivered to the tissues per minute,…
Q: How did the diverse feeding appendages of arthropods arise?
A: Introduction Arthropoda, a subclass of invertebrates with an exoskeleton, is the biggest phylum in…
Q: II. Identify the numbered parts of a typical plant cell. 1. 2. 3. 4. 11. 10. 5. 9. 8. 6. 7.
A: The plant cells are eukaryotic cells that contain membrane bound cell organelles. The presence of…
Q: When farmers learn that an overnight freeze is expected, they spray their crops with water to…
A: Temperatures plummets down in winter and freeze can occur and the clear skies and falling afternoon…
Q: Make a schematic diagram of the key events in the stages of mitosis.
A: The process of mitosis occurs in somatic cells so it is known as somatic cell division. In mitotic…
Q: How did the diverse feeding appendages of arthropods arise?
A: Arthopods are invertebrate animals having an exoskeleton, a segmented body and paired jointed…
Q: 5. Given the following information tables, determine in which cell type cleavage of the terminal…
A: The ATP is the adenosine triphosphate molecule, which contains the three-phosphate group, by means…
Q: Briefly explain differences between alkaline and acidic diet
A: Introduction :- Certain dietary categories are regarded as neutral, alkaline, or acidic: Meat,…
Q: Over time, a child gets bit by several different kinds of snakes and becomes ill each time. The…
A: One thing all forms of science have in common is the ultimate goal of "knowing." Curiosity and…
Q: 8. frame shift mechanism contributes to the following a. Somatic hypermutation b. class switching -…
A: 8. C.Gene conversation Frame shift mutation mainly occurred through the process replication. This…
Q: What is meant by a “high-energy bond,” and why might the production of molecules with such bonds be…
A: Upon hydrolysis, a chemical bond that produces 30kJ of energy; if coupled to an unfavorable…
Q: ich of the following would be considered evidence of species descent from ommon ancestor under the…
A: The concept of natural selection was first explain by Charles Darwin. According to this concept…
Q: Q1. An HIV crime in Washington In 2004, a 32-year old man in the state of Washington was accused of…
A: Based on the similarities and the differences among the organisms and the species, they are grouped…
Q: Q1: Which two children in this pedigree have cystic fibrosis? How do you know? Q2: Does either parent…
A: Cystic fibrosis is an autosomal recessive disorder.
Q: What will happen if cell inoculum density is more than 300
A: Introduction The population of microbes or cells injected into the fermentation medium, or any other…
Q: 12
A: We can say that The kidneys are bean-shaped organs and reddish-brown that are found in the posterior…
Q: Which of the following statements is true regarding pili and flagella assembly? O Pili and flagella…
A: Pili are the short and straight hairlike structures of prokaryotic cells present on their outer…
Q: Writing/Response Prompt: Theorize about the following - Where do harmful genes that contribute to…
A: Each organism's DNA sequence is unique. Its base-pair sequence might vary from time to time. It is…
Q: Why is the effectiveness of "herd immunity" so hotly debated within the SCIENTIFIC community
A: Herd immunity : it is the immunity when a large part of a population becomes immune from a…
Q: Can changes in allele frequencies cause genetic drift and is genetic drift always random ?
A: Genetic drift is the change in allele composition due to random chances of sampling errors. The…
Q: replication, transcription, and translation
A: Central Dogma of Molecular biology: It is defined as the process of flow of genetic information in…
Q: Explain one purpose of LPS (lipopolysaccharides)
A: Let's first break down the word to understand the meaning of polysaccharides. The word "saccharide"…
Q: How many copies of each gene are found in the diploid cells in a woman’s body?
A: Introduction Any cell contains a specific number of chromosomes it is referred to as ploidy level or…
Q: In the "biochemical assay of b-galactosidase activity", what is o-nitrophenyl-b-D-galactosidase…
A: Introduction The lac operon model was first proposed by F. Jacob and J. Monod. Lac operon an…
Q: If you wanted the most variable litter possible, what colors of Labrador retrievers would you cross?
A: Labrador retrievers are the most friendly dogs. They are good companions and working breeds.…
Please answer fast
Step by step
Solved in 2 steps
- Match the correct answer to each blank. Note that each answer (1 through 4) can be used more than once Eukaryotic mRNAs Prokaryotic mRNAs Transfer RNAs Ribosomal RNAs 1. They contain exons and introns _____ 2. They are the template of genetic informtaion during protein synthesis ______ 3. They contain unusual or modified nitrogenous bases ______ 4. They display an anticodon each ______ 5. They have a cloverleaf structure ______ 6. They are synthesized by RNA polymerases ______ 7. They get charged with an amino acid by aminoacyl-tRNA synthetase ______ 8. They are capped on their 5' ends and polyadenylated on their 3' ends 9. There are 4 types of these in eukaryotes and only 3 types in E. coli ______Polypeptides can be reversed back to RNA because of the enzyme transcriptase. The genetic material must be replicated with high fidelity and great speed. Eukaryotic mRNA is said to be polycistronic since they encode multiple polypeptide chains RNA-synthesis occurs inside the nucleus while protein synthesis in the cytoplasm of eukaryotic organisms. Write T if the statement is true and write F if the statement is falseA small section of mRNA codons has the following sequence:UGG GAA ACC UUC Some Amino Acids Aspartate Glutamate Glutamine Isoleucine Threonine Methionine Asparagine Tryptophan Phenylalanine The amino acids listed above that are coded by the mRNA codons are Answer, Answer, Answer, and Answer.Record your answer in order from left to right codons.
- Below is the sequence of an mRNA that has just been transcribed. Please translate this sequence as if you were a ribosome, and write out the translation results. A genetic code table has been provided. mRNA: 5'- A C G U C C A A U G G C A G U G A U U U G A A U C C A -3'Anticodons are located on __ Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a MRNA b TRNA FRNA d none of the aboveThe sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.
- Match the correct answer to each blank. Note that each answer (1 through 4) can be used more than once Eukaryotic mRNAs Prokaryotic mRNAs Transfer RNAs Ribosomal RNAs 1. They are capped on their 5’ ends and polyadenylated on their 3’ ends 2. They contain unusual or modified nitrogenous bases 3. There are 4 types of these in eukaryotes and only 3 types in E. coli 4. They contain intronsA small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1. Valine 2. Serine 3. Proline 4. Glycine 5. Arginine 6. Leucine 7. Histidine 8. Cysteine 9. Glutamine The amino acids listed above that are coded by the MRNA codons are , and Record your answer in order from left to right codons.Using the mRNA sequence you made, translate this into a protein sequence. Begin translation at the first AUG (start codon) in the sequence, starting from the mRNA 5’ end. When writing the amino acids that are found in the protein, you may use the single-letter code, three-letter code, or full amino acid names.
- Complete what is being asked and finally with the Genetic Code table, determine what specific amino acids will be finally formed. Given DNA strand 3’ T A C T A G C C T A C T G C G 5’ 1. The partner strand of the given _________________________________ 2. The mRNA strand formed _____________________________________ 3. The tRNA _________________________________________________ 4. The amino acids formed are __________________________________At least three types of RNA are required for protein synthesis. Compare and contrast mRNA, rRNA, and tRNA by moving the descriptions of their structure and function to the appropriate categories. Some phrases may describe all three types of RNA. mRNA in eukaryotes, can exist outside the nucleus acts as an enzyme for peptide synthesis composed of ribonucleic acid rRNA Answer Bank moves amino acids to the site of protein synthesis tRNA contains nucleotide triplets that code for specific amino acids has a convoluted structure with a three-base sequence called an anticodon moves genetic information out of the nucleus and into the cytoplasm mRNA, rRNA, and tRNATranslate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don't worry about start and stop codons. Write out the sequence using the single letter code. (This table displays the amino acids in a single-letter code instead of a three-letter code. Each codon is found by matching the first position on the left of the chart, second position at the top, and last position at the right. For example, the codon CAG gives the amino acid "Q") 5' UCAACUGCGAAUCUGGAAUAU 3'