A small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1. Valine 2. Serine 3. Proline 4. Glycine 5. Arginine 6. Leucine 7. Histidine 8. Cysteine 9. Glutamine The amino acids listed above that are coded by the MRNA codons are , and Record your answer in order from left to right codons.
Q: How many different mRNA sequences can encode a polypeptide chain with the amino acid sequence…
A: Polypeptide chain includes a sequence of amino acids that are coded by different codons during the…
Q: What amino acid is coded for by each codon? a. GCC b. AAU c. CUA d. AGC e. CAA f. AAA
A: GCC -Alanine AAU - Asparagine CUA - Leucine AGC- Serine CAA - Glutamine AAA - Lysine
Q: The genetic code is defined as a series of _______________ in _______________. (a) anticodons;…
A: The genetic code, anticodons, codons, mRNA, and tRNA are all involved in the expression of a gene. A…
Q: Order of Order of Order of Amino Acid bases bases in MRNA | (codon) bases Coded into in DNA in TRNA…
A: As we know DNA contains A T G C Bases and RNA Contains A U G C Bases. mRNA is complementary to DNA…
Q: Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the…
A: Each codon is made up of three nucleotides, each of which corresponds to a single amino acid. The…
Q: If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is…
A:
Q: The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT Give the mRNA…
A: Answer: CENTRAL DOGMA : It is the complete process of replication of DNA , transcription of DNA and…
Q: Use the codon chart to translate this RNA sequence into amino acids. *Hint* Pay attention to start…
A: When we have to translate a genetic sequence into amino acid we use stand table known as codon chart…
Q: Methionine is also known as Select one: a. the start codon b. the stop codon c. isoleucine d.…
A: Methionine is an amino acid that consists of a sulfur atom in its side chain. It is a part of many…
Q: DNA C A T G C U MRNA U UG ERNA ionine Amino Acids is synthesized in translation or transcription?…
A: Transcription is the synthesis of m RNA from a DNA template. The translation is the synthesis of a…
Q: CODON that corresponds with each amino acid
A: During translation where mRNA is being translated to proteins the sequence of nitrogen bases on the…
Q: The circled portion labeled Y is known as a(n): O ribosome O DNA molecule codon TRNA molecule O…
A: The translation occurs in the cell's cytoplasm. Firstly, a nascent mRNA or pre-mRNA synthesized by…
Q: DNA A G T A C C G G G C A A A C T G C A T T G T G mRNA U C A U G G C C C G U…
A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…
Q: How many amino acids are coded for by one codon? O a) 1 O b) 2 O c) 3 O d) 4
A: The sequence of three nucleotides of DNA and RNA is known as Codon. There are 64 different codons…
Q: Which of the following codons is called the start codon?
A: AUG is the Start codon, which codes for Methionine.
Q: Complete the phrases with the correct word or words. The task is to match the lettered items with…
A: Genes are sets of nucleotides that codes for a particular protein. The genes have to be expressed…
Q: Complete the table below showing the sequences of DNA, MRNA codons, RNA anticodons and the amino…
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: A…
Q: 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Copy the template strand…
A: DNA sequence is given. Top strand acts as template for mRNA synthesis. Top strand sequence is 3’…
Q: Shown below is a DNA coding strand: 5' T-A-C-T-T-C-C-C-G-A-T-C-A-T-T 3' Using the genetic code…
A: The genes in DNA encode protein molecules, which serve as the cell's "workhorses," performing all…
Q: Which one of the following is true of tRNAs? O Each TRNA binds a specific amino acid. TRNAS are…
A:
Q: Here is our DNA sequence: T-A-C-A-T-G-T-T-T-A-G-G-T-C-C-A-C-C-C-G-T-G-G-G-A-C-T Write the RNA…
A: Introduction The process by which the genome's DNA is copied in cells is known as DNA replication.…
Q: The coding strand of DNA in a segment of a gene is as follows: ATG GGC CTT AGC. This strand carries…
A: The DNA (deoxyribonucleic acid) duplex consists of a non-template and a template strand. The…
Q: A particular triplet of bases in the template strand of DNA is 5' AGT 3: The corresponding codon for…
A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…
Q: 3. Below is part of the DNA genetic code for six amino acids. TTT AAA Codes for phenylalanine САА…
A:
Q: An anti-codon is on what kind of molecule? O DNA O TRNA O polypeptide O MRNA
A: An anticodon is a tri-nucleotide sequence which is complementary to the codon sequence present on…
Q: Which of the following have codons? amino acids acetyl transferase FRNA RNA polymerase proteins TRNA…
A: The DNA is the genetic material of the living organisms like humans. This molecule carries the…
Q: Each combinations of nitrogen bases on the mRNA molecule is a codon, which is a three letter code…
A: 4) tryptophan- UGG 5) Leucine- CUU, CUC, CUA, CUG
Q: Which of the following amino acid changes could result from a mutation that changed a single base?…
A: Amino acids are the structural units of proteins. They are involved in several metabolic pathways by…
Q: The found in the MRNA is complementary to the found in the TRNA. O anticodon, anticodon O anticodon,…
A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…
Q: A small section of mRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids…
A: mRNA is a ribonucleotide sequence produced as a result of transcription from DNA. Once the mRNA is…
Q: * Part of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG…
A: Anticodons are nucleotide sequences that are the opposite of codons. They're located in tRNAs, and…
Q: 2. Transcribe the following gene sequence to the appropriate MRNA codons: TCA TTT cCA CAG ACA * AGU…
A: Transcription is defined as the process of RNA formation from the template strand of DNA by the…
Q: Which of the following codons is called the start codon? a.UAA b.UGA c.UAG d.AUG
A: The connection between the series of nucleotide on mRNA and series of amino acid in the polypeptide…
Q: Which of the following statements about codons in prokaryotic cells and eukaryotic cells is correct?…
A: Option D is correct.
Q: Which base pair in the codon-anticodon is a "wild card" resulting in 32 tRNAs rather than 61?…
A: The 3rd base of the codon do not matters. For example UUU and UUC both codes phenylalanine. This is…
Q: Which of the following is not true of a codon?(A) It may code for the same amino acid as another…
A: The genetic code involves the set of rules determining the conversion of nucleotide sequence into a…
Q: The following sequence represents triplets on DNA:TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA…
A: Hello, thank you for your question. The second part of the question seems to be incomplete,…
Q: following is a series of DNA triplets. first, transcribe the correct complementary sequence of mRNA…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: If the codon for Histidine is 5' CAU 3' in an MRNA molecule, the anticodon on the TRNA is: UAC ATG…
A: In every group of messenger ribonucleic acid (mRNA), there are three bases. A codon is also there…
Q: What is the functional relationship between codons and amino acids? A Many different codons may…
A: The translation is a molecular process that involves the synthesis of protein by the formation of…
Q: Which one of the following is true of tRNAs? TRNAS have special sequences called codons. Each TRNA…
A: Transfer ribonucleic acid (tRNA) is a kind of RNA molecule that unravels a messenger RNA (mRNA)…
Q: An RNA sequence includes 15 codons. How many amino acids does this sequence encode? O 3 05 15 O 45
A: Genetic code is a combination of rules, which allows the translation of information encoded in the…
Q: You are studying two mRNA sequences. The nucleotides in the first sequence are in the correct order:…
A: As per the 1st sequence of bases given, the amino acids present would be- Gly-Arg-Cys After the…
Q: Which of the following is true about the genetic code? O The first position of the tRNA anticodon is…
A: Genetics is a biology branch that deals with the study of genes, their variation, and heredity.…
Q: transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: 8. Codons are sequences that correspond to specific amino acids or signals during protein…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: The mRNA codon of valine is GUC UGG CCA TTG
A: Each codon in mRNA is made up of three nucleotides, and each codon indicates a certain amino acid…
Q: Provided below are strands of DNA. The first one has been done for you. First transcribe the code…
A: Answer: CENTRAL DOGMA = It is the complete process of replication of DNA , transcription of RNA ,…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Most codons specify an _________ . a. protein c. amino acid b. polypeptide d. mRNAThe genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNAUse the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letter
- 5. Below is a segment of RNA, transcribed from a DNA sequence. Use the following codon chart to help answer the questions below. 5' AUG/CCU/ACG/GAC/UGG/CCU 3¹ First Letter U C A The genetic code Second Letter A U с G phenylalanine serine tyrosine cysteine phenylalanine serine tyrosine cysteine leucine serine stop G leucine leucine leucine leucine leucine serine proline isoleucine start/ stop histidine stop tryptophan arginine proline histidine arginine proline glutamine arginine proline glutamine arginine threonine asparagine serine isoleucine isoleucine threonine asparagine serine threonine lysine arginine threonine lysine arginine methionine valine valine valine valine a. What polypeptide would be generated by this sequence? alanine aspartate glycine alanine aspartate glycine alanine glutamate glycine alanine glutamate glycine Third Letter DUAGUUAGUUAG C с А UCAG b. The RNA is mutated to: 5' AUGCCCACGGACUGGCCU 3. What type of mutation has occurred? Show the new polypeptide chain. c.…(ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’
- The name for the kind of point mutation/base substitution when a codon changes from CCC (which codes for proline) to CGC (which codes for arginine) is mutation. 2nd base in codon U CAG Cys Cys STOP STOP Trp Arg Arg Arg Arg Ser Ser Arg Arg Gly Gly Gly Gly Phe U Phe Leu Leu Ser Ser Ser Ser Tyr Tyr STOP Leu Leu Leu Leu Pro Pro Pro Pro His His Gln Gln C Asn Asn lle lle lle Met Thr Thr Thr Thr Ala Ala Ala Ala Lys Lys Asp Asp Glu Glu Val Val Val Val 3rd base in codon DCAGUCAGUCAGUCAG 1st base in codonThe mRNA codon of valine is GUC UGG CCA TTG3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…
- If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- GTable 1. The Genetic Code: Codons and Their Amino Acids First Two Nucleotides of Codons Last Nucleotide of Codons The Amino Acids A UU phe phe leu leu Abbreviations Names UC gly glycine ser ser ser ser UA tyr tyr term ala alanine term val valine UG cys cys term trp ile isoleucine leu leucine CU leu leu leu leu ser serine CC pro pro pro pro threonine proline aspartate glutamate lysine arginine thr CA his his gin gin pro asp glu lys CG arg arg arg arg AU le ile ile met AC thr thr thr thr arg asparagine glutamine cysteine methlonine asn AA lys lys asn asn gin AG ser ser arg arg cys met GU val val val val trp phe tryptophan phenylalanine tyrosine histidine GC ala ala ala ala tyr his GA asp asp glu glu GG gly gly gly gly term termination 3. Use Table 1 to read the codons below. Find the name of the amino acid and write it in the space provided. If the letters code for more than one amino acid, separate the names by dashes. b. UUA: c. GAG: d. UAUCUA: e. AUCUUG: f. AAGAGUUCG: g. AAAUUUGGG: h.…The following is a section of a messenger RNA: 5' GACUACAUA 3' Look at the sequence carefully and using the following genetic code, translate the MRNA into an amino acid sequence. Second Letter U A G Phe uCu UC | Tyr UGU Cys u UUU U UUC UUA UUG UAU UAC UAA UAG UGC Stop UGA Stop A Stop UGG Trp G Ser UCA UCG Leu CAU CAC САА CAG CU CU His CGU U c Cuc CUA CUG Leu cc CCA CG CGC Arg CGA CG Pro Gin A 3rd G 1st letter AUU Ser u letter ACU lle ACC ACA AAU Asn AGU Thr AAC AAA A AUC AGC AUA AGA | Lys A Arg G AUG Met ACG AAG AGG Asp GUU G GUC GUA GCU GAU GAC GAA GGU GGC Gly Val |GCC GCA GCG Ala GGA GGG A Glu GUG GAG G O Tyr-Val-Val O Asp-Tyr-lle O Leu-Met-Tyr O lle-His-Gln O Asp-Thr-Leu-Tyr-Thr-His-lle 星