Q: In radish the effect of the alleles producing the red long variety is incompletely dominant over the…
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: If you worked for a pharmaceutical company and wanted to develop a vaccine to prevent viral…
A: Through TQM, both upper-level management and front-line workers are incentivized to focus on the…
Q: 4b. Describe how the Bohr effect helps to transport CO2 from tissues to the lungs and to remove CO2…
A: Introduction Christian Bohr, a well-known scientist, was the one who initially studied the Bohr…
Q: there is a cellular sack that is impermeable to starch molecules and is filled with a solution,…
A: Tinicity is the term we use when a solution have ability to move water in and out of the cell with…
Q: Draw a picture of mitochondria. label the inner membrane, outer membrane, Inter membrane space and…
A: Mitochondria is the powerhouse of the cell. This organelle is involved in cellular respiration that…
Q: What are some interesting facts of Equality in the Sexes in Human Evolution?
A: Sexual dimorphisms are traits that consistently differ between males and females. The term…
Q: Describe pinocytosis, phagocytosis and receptor mediated endocytosis.
A: Describe pinocytosis, phagocytosis and receptor mediated endocytosis.…
Q: Gluconeogenesis cannot use as a substrate. O Pyruvate O Alanine O Glutamate Palmitate
A: Glucose is an important carbohydrate molecule that is central to energy consumption. This glucose is…
Q: In Lassaigne Nitrogen Test, If a substance is positive for nitrogen, what functional groups may the…
A: Lassaigne Nitrogen Test: In elemental analysis, the sodium fusion test, also known as Lassaigne's…
Q: 4) Differentiate between and describe the three types of phosphorylation as discussed in the lecture…
A: Phosphorylation is the process in which ADP reacts with inorganic phosphate to form ATP. This…
Q: If you have an mRNA sequnece below that looks like : 5' cap, Cytidine, CCUCUUUUCC, gene, AAAAA…
A: Messenger RNA or mRNA is a single stranded RNA synthesized from a DNA template by a process called…
Q: Compare Illumina/Pacbio/Nanopore sequencing methods. 2. How do you construct the profile matrix?…
A: There are an increasing number of studies using third-generation sequencing that make use of Pacific…
Q: major problem with morphologically based analysi
A: As the name indicates, the morphology-based analysis only considers the visible characteristics of…
Q: CH₂OH OH OPO3-2 OH
A: Glucose is stored in the form of glycogen in the body. Glycogen is broken down to form…
Q: For each wet mount, describe the appearance of the red blood cells, determine the solution's…
A: The Tonicity of the solution is defined as the capability of the solution to alter its volume by…
Q: INSTRUCTION: Answer the question properly Do not copy in Google, plagiarize checker will be used.…
A: Gram-positive bacteria are bacteria classified by the color they change in the staining method. Hans…
Q: some human traits that follow the simple dominant/ recessive pattern as in Mendelian controlled…
A: Mendelian inheritance is the inheritance of traits controlled by a gene which will be dominant to…
Q: List 5 examples of types of fossils
A: Fossils are the preserved dead remnants trapped in rocks or layers of soils of living organisms that…
Q: 7. A segment of DNA from Hippopotamus amphibius has the sequence below. Assuming that this is the…
A: The mRNA produced by the process of transcription. RNA polymerase enzyme utilised in the process of…
Q: Part The relationship between the breakdown of macromolecules and the biosynthesis of macromolecules…
A: Ans: Food provide us the fat, protein, carbohydrates that give the body to building blocks to…
Q: Based on the Tonicity in Elodea Cells lab, a hypotonic environment causes a cell to swell or burst…
A: Tonicity The tonicity word is used to describe the concentration of a solution. A solution may be…
Q: Describe and correlate the structures and physiology of the different organ systems.
A: We are allowed to do one question or upto three subpart of a question. Please repost the undone…
Q: List examples that illustrate how the structure of a body part makes possible its function
A:
Q: Bacterial ribosomes __________. comprise two tRNA binding sites, three rRNA subunits, and…
A: All cells' ribosomes are macromolecular structures that serve as the locations for protein…
Q: One of the characteristics of botulinum toxin (the cause of 'botulism') is a very specific protease…
A: Neurotransmitters A chemical that secreted by the ends of nerve fiber into the synaptic cleft.
Q: Not being able to inhibit pyruvate dehydrogenase, despite high levels of NADH or ATP, could cause…
A: pyruvate dehydrogenase complex is the enzyme complex which convert pyruvate to Acetyl CoA, NADH2 AND…
Q: Why does touching you imply something?
A: Physical touch is a method of communication that does not require verbal communication or writing to…
Q: Hello, please read the attached Microbiology question and answer correctly. *If you correctly…
A: Bacterial species which are responsible for causing pneumonia are Streptococcus pneumoniae and…
Q: Follicle-stimulating hormone stimulates the production of a. steroids in the adrenal cortex. b.…
A: Introduction : Endocrine glands produce hormones, which are specific chemical messengers that are…
Q: As a global citizen, how can you save the life below water
A:
Q: Q4. You conducted an experiment similar to Morgan's fruit fly but you used honey bee instead. You…
A: Linkage is a phenomenon in which genes are exhibited on the same chromosome instead of another .…
Q: plant and animal development.
A: Development: It is defined as the the progressive changes in size, shape and function during the…
Q: Sequence the steps to transfect and observe a fluorescent protein in a slice of the brain:
A: Transfection is the process of artificially introducing nucleic acids (DNA or RNA) into cells,…
Q: Which of the processes does not lead to variation in offspring with the same parents?* A.…
A: variation means any difference between cells or individual organisms of any species caused either by…
Q: Student Y is working with his microbiology experiment, the directions of the agar is to suspend 25g…
A: In microbiology experiment, we generally use 15-20ml media for each petri dish. Here we can consider…
Q: Activation of certain GPCRs triggers an intracellular signaling mechanism that involves activation…
A: The most numerous and varied class of membrane receptors found in eukaryotes are G-protein-coupled…
Q: In your own words, explain why DNA binds to the silica column
A: Introduction: Using molecular dynamics simulations, the DNA-silica binding mechanism is as. This…
Q: A population consists of 300 individuals with the following genotypes: AA – 100…
A: . The Hardy-Weinberg principle states that allele and genotype frequencies in a population will…
Q: During pregnancy, FSH and LH levels should be: High-progesterone stimulates the release of FSH and…
A: We know that Female body undergoes various hormonal changes during pregnancy. Hormonal fluctuations…
Q: D In the following DNA strand, find the position of the start codon, stop codon and determine the…
A: The given DNA strand - GGTACTTTATACCCTGATACATTTGTGGGG Corresponding mRNA strand -…
Q: Both NADH and FADH2 molecules pass electrons to
A: Cellular respiration is a metabolic process involving a series of three major steps that metabolize…
Q: Which pituitary hormone is represented by the abbreviation ADH? A Antidiuretic hormone B Adrenal…
A: Vasopressin is a hormone released by the posterior pituitary gland (located at the base of the…
Q: How does what you see on the acrylamide gel reflect what is presented on a sequencing chromatograph
A: Polyacrylamide gels have served as an important tool to investigate the effect of substrate…
Q: Continue to assume that the same four individuals in the pedigree are albinos, and calculate the…
A: As per the guidelines, we are supposed to answer only three sub-parts. Kindly repost the question…
Q: 25 26 27 28
A: Introduction A typical cell can divide by two processes one is Mitotic cell division and the second…
Q: Ribosomal prote 4. Eukaryotic ribosomes have some similarities to prokaryotic ribosomes, but they…
A: Prokaryotic cell do not have membrane bound organelles however eukaryotic cells do have. Prokaryotic…
Q: I need help with a biology question on enzyme denaturation, I need help with questions, one and two,…
A: The altering of a protein's molecular structure is known as denaturation. During denaturation, many…
Q: Observations in a Park 1. A rabbit is eating grass. 2. A robin is resting on a nest of blue eggs. 3.…
A: Observation .1. 1. A Rabbit is eating Grass. Every living thing on Earth, no matter how large or…
Q: In a true breeding parental cross for an Autosomal recessive disease trait, the expected proportion…
A:
Q: Create a mind-map about the concepts you know, or understand about Dental Public Health.
A: Introduction Individuals can benefit from dental care. A good root canal or filling can…
Step by step
Solved in 2 steps
- A cell in G1 of interphase has 8 chromosomes. How many chromosomes, and how many DNA molecules will be found per cell as this cell progresses through the following stages: G2, metaphase, anaphase, and after cytokinesis?Describe the cell cycle using the following words: Interphase G1 G2 S phase M phase (mitosis) Prophase Metaphase Anaphase Telophase Cytokinesis Apoptosis Check Points feedbackMatch these cell division phases with the appropriate processes Break down of the nuclear membrane [ Choose ] allowing mitotic spindles to connect to [Choose ] Telophase Metaphase Anaphase Prometaphase Cytokinesis Interphase kinetochores APC degrades securin which allows separase to become active which degrades the cohesin rings Dephosphorylation of nuclear pore and lamins cleavage of plasma membrane by actin and myosin contractile ring [ Choose ] copying of the genome [ Choose ] formation of the metaphase plate [Choose ]
- 1. Your colleague is running an experiment on cell cycle. He grows cells in three conditions: control, addition of chemical X (which induces cell division), and addition of a chemical Y (which disrupts formation of microtubules). He adds each condition to a different microscope slide and stains the cells with fluorescent reagents to highlight the DNA. Only after he is done, he realizes that he forgot to label the slides! Below is a graph of the results he collected from each slide. To which experimental condition (control, Chemical X, or chemical Y) does each slide correspond to? Explain your rationale.This subphase of interphase is characterized by 2 copies of DNA: G1 S2Biology Question
- 94 l which phase of cell division in this figure? microtubulus 2 push polas apart kinatochore mierotulbulus pull chromeSomes tasardo polas telophase O prophase anaphase metaphase All the following is the function of proteins EXCEPT: response to stimuli Catalyzing metabolic reaction Transport a molecules from one location to another Detoxify of some toxic substances such as drugsA cell in G1 of interphase has 12 chromosomes (2 n = 12). How many chromosomes and DNA molecules will be found per cell when this original cell progresses to After cytokinesis following mitosis?The stage of mitosis when sister chromatids separate from each other and migrate to opposite poles of a cell is called O telophase anaphase metaphase prophase O interphase
- These types of proteins are responsible for all the following events during cell division: movement of "chromosomes" to poles, sliding of non-kinetochore microtubules pushing the two ends of the cell apart, and also the production of the cleavage furrow during cytokinesis. They are called _ _ (two words)Cell specializations are usually a modification or elaboration of one of the basic cell functions. (True or fa1se?)S. Chromosomes are duplicated during what stage of the cell cycle? G1 phase S phase prophase prometaphase