The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. ССТАССТТАТGССАAGTTGGGGАТАААСТС The left end of this molecule is the end. How many amino acids will be in the protein translated from this sequence? What is the name (not abbreviation) of the fourth amino acid in the protein translated from this sequence? The label on the end of the protein that is translated first is the end.
Q: G C T A T A A T G G C A a a a t t g G G T C A G G C A a a t c g a C A T A G C T G A C G G g g a t g…
A: Dna is read in 5 ' to 3 ' direction and the mrna is read by the trna in the form of genetic code by…
Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Which of the following could be the mRNA codon, the codon on the DNA sense strand, and the codon on…
A: DNA => Transcription => mRNA => Translation => Protein. In DNA: 5' - 3' strand is called…
Q: The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this…
A: DNA sequence of genes code for the sequence of amino acids in proteins. There are two strands in…
Q: Given below is a DNA sequence as well as its corresponding mRNA and protein amino acid sequences.…
A: Mutation basically refers to the random change in the DNA sequence. These changes can result in a…
Q: In which of the following would you find the start codon sequence of a gene? mRNA DNA and…
A: Codons are made up of three consecutive nucleotides. The sequence of start codon is AUG. It…
Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:
A: This question is based on the functioning of mRNA expression.
Q: If the sequence of one strand of a DNA molecule is 5’-AGCCCCGACTCTATTC-3’, what is the sequence of…
A: DNA : Deoxyribonucleic acid is a double stranded molecule in which two strands are anti parallel and…
Q: The template strand of a double helical segment of DNA consists of the following sequence:…
A: INTRODUCTION: Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that…
Q: 1. Below is an amino acid sequence for the following strand of DNA: A G C A A T C C G T C T T G G T…
A: Ans 1 : Point mutation
Q: A DNA sense strand contains the following nucleotide base sequence: TAC AGC AAT CAC From this,…
A: Sense strand is a coding strand that does not code for mRNA. Complementary base pairing occurs in…
Q: A small section of a gene for a protein has the following nucleotide sequence: TAT CTG GCT GTC CAA…
A: Mutation is defined as the sudden and permanent change in the nucleotide sequence of DNA. Missense…
Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…
A: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide…
Q: Refer to the partial gene sequence of DNA nucleotide bases listed below, and the genetic code chart…
A: The series of mechanism by which a DNA sequence is is transcribed into RNA, and mRNA is translated…
Q: Consider a portion of a gene in a cell with the sequence TTTTT. Which of the following bases would…
A: The correct answer is C) A-A-A-A-A; nucleus .
Q: The compound known as nitrous acid is a reactive chemical that replaces amino groups (−− NH2) with…
A: The given compound nitrous acid substitutes the cytosine(C) with uracil (U) and adenine (A) with…
Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…
A: Introduction Transcription is a process by which mRNA is produce from DNA. Once the mRNA is formed…
Q: Yes, all mutations change the resulting protein. No, the amino acid sequence has not been changed.…
A: Deoxyribonucleic acid (DNA) is the material that carries inheritable information to the succeeding…
Q: Consider the following wild-type double-stranded DNA sequence: 5' TATGAA AGT3 non-transcribed strand…
A: A gene mutation that results from the substitution of one base pair of another. TATGAAAGT non…
Q: What will be the sequence of mRNA produced by the following stretch of DNA? 3' ATCGGTTAAC 5'…
A: Transcription is the process of synthesis of an RNA molecule from the DNA template strand. Where RNA…
Q: One half of a DNA strand has the following sequence of bases GCTACGGCGTTATCCCC. What would appear on…
A: In a DNA molecule each deoxyribonucleotide is made up of a sugar, nitrogenous base and phosphoric…
Q: Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into…
A: Deoxyribonucleic acid is the genetic material found within a cell's nucleus. Before cell division,…
Q: The template strand of a segment of double-helical DNA contains the sequence –…
A: Introduction: DNA is a type of nucleic acid present in the nucleus of the cell. It is the genetic…
Q: If this sequence of bases was on one side of a DNA moléčulé, whát wõuld be on the opposite side?…
A: The answer is TTTAGCC. The last option.
Q: Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into…
A: ANSWER;-
Q: A small section of a gene for a protein has the following nucleotide sequence: GCT CTA GCT ATC TGA…
A: Introduction A silent mutation is a kind of point mutation where the mutation does not affect the…
Q: If the mRNA molecule from your answer to the previous question is going to be translated into a…
A: The gene is the portion of DNA that codes for a specific protein. First, the DNA is converted to…
Q: If one DNA strand has the nucleotide sequence below, what is the nucleotide sequence on its…
A: DNA and RNA are the two types of nucleic acids. Deoxyribose nucleic acid (DNA) is present in all…
Q: Which of the following mRNA codons could be changed to a stop codon by a single base pair…
A: A codon consists of three-nucleotides (A, G, C, or U) of RNA and carries the genetic information.…
Q: Write the sequence of the DNA strand complementary to the following strand:…
A: DNA or Deoxyribonucleic acid is the double helical structure, present in each and every cell of all…
Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…
A: Given DNA strand: 5' - CCTATGCAGTGGCCATATTCCAAAGCATAGC - 3'
Q: dna nucleotide sequence ATCGGATCGA What structure of dna does the sequence represent
A: DNA is the genetic material in all the living organisms.
Q: complementary DNA sequence
A: Answer: Complementary sequence: Nucleic acid sequence of bases that can form a double- stranded…
Q: If the following changes occurred in the gene, identify the type of mutation and how it would affect…
A: Codon is a triple of nucleotide base pair. Any change in the sequence resulting in altered phenotype…
Q: Using the codon chart, if the DNA strand being described is AGG TCT GAT , the resulting amino acid…
A: The order in which amino acids are found in a protein. Proteins are made up of 20 different types of…
Q: A gene is a piece of DNA that codes for a protein. Genes are transcribed into mRNA and are on the…
A: Sometimes mutation disrupts protein synthesis by substitution, deletion, or insertion of one or more…
Q: What amino acid sequence will be generated, based on the following DNA codon sequence? Did you read…
A:
Q: What is the sequence of amino acids coded by the following sequence of nucleotides on a strand of…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: A G C A A T C C G T C T T G G T C G T T A G G C A G A A C C That strand has mutated. It is now A…
A: Mutation A change in the sequence of DNA bases that may or may not causes serious problem in an…
Q: Given the following sequence of nucleotides of a template DNA strand, predict the sequence of mRNA…
A: The DNA nucleotide sequence given above is- 3' CGTACGCCGAGACGTCAAC 5' (Template DNA strand) The mRNA…
Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…
A: Introduction : The genetic code is the set of rules by which information encoded within genetic…
Q: The template strand of a double helical segment of DNA consists of the following sequence: 5’-…
A: Hi! Thank you for the questions. As you have posted questions with multiple subparts, I will be…
Q: For the following sequence of amino acids, serine-valine-lysine-leucine, which of the choices below…
A: Given: a sequence of amino acids, serine-valine-lysine-leucine
Q: Using the example above, transcribe the following DNA strand into mRNA and translate that strand…
A: During transcription, the enzyme RNA polymerase uses DNA as a template to produce a pre-mRNA…
Q: Which of the following choices best match the blank? Three-nucleotide segments of RNA called…
A: Amino acids are the monomers or structural units that are responsible for protein formation. The…
Q: What is the complementary DNA sequence to the following DNA sequence? ATGCCATCG…
A: DNA is genetic material which is involved in transfer of information into the protein. It involves…
Q: What do you notice about the orientation if the nucleotides in a DNA molecule? Please be straight…
A: the self replicating by molecules that are present in the chromosome and carry genetic information…
Q: If one strand of DNA has the sequence 5'-C-T-A-G-C-G-T-T-A-3', what sequence would appear opposite…
A: DNA is the genetic material that involves the transfer of information from one generation to the…
Q: If the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the…
A: DNA strand – DNA is a Deoxyribonucleic acid. It is made up of two polynucleotide chains which are…
Q: Shown below is a DNA coding strand. A base (*G*) mutates to Adenine (A). What will be the resulting…
A: In this question, we are given a coding strand of DNA which has undergone mutation from *G* to A. A…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Note, the answer blanks for mRNA may appear vertically on some displays. In this case, enter the bases from top to bottom. Then, for each set of three DNA and complementary mRNA nucleotides, use the amino acid chart to translate the nucleotides into amino acids, and type them below. Enter the full, unabbreviated name of the amino acid in the blank provided. In the case of a stop codon, enter "Stop"Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.Part of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG Part of a sequence of DNA from a person with a genetic disease is: TAG TAA CCA CCC AGG The possible codons for some amino acids are shown in the table. Amino acid Codons glycine GGU GGC GGA GGG isoleucine AUU AUC phenylalanine UUU UUC serine UCU UCC UCA UCG Which amino acid is missing from a person with this genetic disease? serine glycine O phenylalanine isoleucine
- Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?A portion of the sequence from the DNA coding strand of the chick ovalbumin gene is shown. Determine the partial amino acid sequence of the encoded protein. CTCAGAGTTCACCATGGGCTCCATCGGTGCAGCAAGCATGGAA-(1104 bp)-TTCTTTGGCAGATGTGTTTCCCCTTAAAAAGAA Enter the 3-letter abbreviation for each amino acid in sequence, separated with dashes, and no spaces (example: xxx-xxx-XXX-XXX...) The amino acid sequence is .1104bp..…........The sequence of a polypeptide is determined by the order of codons that specify the amino acids in the polypeptide. How many different sequences of codons can specify the polypeptide sequence methionine-histidine-lysine? (Use the table to find the number of possibilities.) SECOND BASE UAU UACFTyrosine (Tyr) UAA -Stop codon UAG -Stop codon UUUL UGU Cysteine (Cys) UCU uc UCA FSerine (Ser) uca Uuc Phenylalanine (Phe) UUAL Leucine (Leu) CAU CAC CAA Glutamine (Gin) CAGF UGA -Stop codon uaa -Tryptophan (Trp) CGU сос CGA FArginine (Arg) CU CU Histidine (His) CuA FLeucine (Leu) Cua) Proline (Pro) CCA cca AAU Asparagine (Asn) AGU Serine (Ser) AGC AUU ACU ACC Threonine (Thr) AACF AAA AAGLysine (Lys) AUC Fisoleucine (lle) AUA Methionine (Met) AUG - Start codon ACA ACG AGA AGGFArginine (Arg) GU GACAspartic acid (Asp) GGA GAA Glutamic acid (Glu) Gaa) GcU -Valine (Val) G GUA GCA FAlanine (Ala) Glycine (Gly) 8. 1 4 THIRD BASE 2. FIRST BASE
- In the copies of each sequence below, divide the sequences into codons (triplets) by putting a slash between each group of three bases. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGGA strand of DNA contains this nucleotide sequence: TACTGCCTCCCCATAAGAATT. The corresponding nucleotide sequence of the mRNA strand from this DNA template is as follows: AUGACGGAGGGGUAUUCUUAA. Q: What is the amino acid sequence of the polypeptide that is produced form the mRNA strand? As well, draw a labelled diagram of the mRNA molecule being transcribed from this strand of DNA.For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acid
- What amino acid sequence will be generated, based on the following DNA codon sequence? Did you read this question carefully also? Are you certain? (You may list the three letter abbreviations for the amino acids listed below) DNA Sequence: TAC AAG CCC TAG GCG ATA АТС [a] Table 1. MRNA codons & associated amino acids Second base C G UUU Phe UUC UCU UAU UGU U Тyr UAC Cys UGC UCC Ser UCA UAA Stop UGA Stop A UUA Leu UUG UCG UAG Stop UGG Trp G CUU CCU CAU] His CAC CGU CUC C CUA CGC Leu Pro CCA Arg CGA CAA Gin CUG CCG CAG CGG AUU ACU AAU Asn AAC Thr AAA Lys AAG AGU Ser AGC AUC Ile ACC AUA AGA Arg AGG ACA AUG Met or start ACG GUU GCU GAU GGU Asp GAC U GÚC GCC Ala GCA GGC Val GUA Gly GAA GGA Glu GAG GUG GCG GGG G Cooriaht O Pearson Education. Inc Dublishina as Beniamin Cumminas First base (5' end) Third base (3' end)If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letterThe DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter Gly