The following segment of DNA codes a protein. The uppercase letters represent exons, the lowercase letters introns. Draw the pre-mRNA, the mature mRNA and translate the codons using the genetic code to form th protein. Identify the 5'UTR and 3'UTR. f 5'-AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3 stion

Q: DNA sequence

A: This is defined as the process in which cells make proteins. This occurs in 2 stages which include…

Q: Examine the following coding strand DNA nucleotide sequence,representing the complete gene sequence…

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: A…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:

A: This question is based on the functioning of mRNA expression.

Q: The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT   Give the mRNA…

A: Answer: CENTRAL DOGMA : It is the complete process of replication of DNA , transcription of DNA  and…

Q: Refer to the double stranded DNA molecule with the sequence below to answer the following questions:…

A: The process of conversion of deoxyribonucleic acid (DNA) into ribonucleic acid (RNA) is called…

Q: TACTGCCTCCCCATAAGAATT

A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: A section of an mRNA has the following nucleotide sequence: ACU UGC AGU GGU GUA For the mRNA…

A:

Q: A small section of a gene for a protein has the following nucleotide sequence: TAT CTG GCT GTC CAA…

A: Mutation is defined as the sudden and permanent change in the nucleotide sequence of DNA.  Missense…

Q: Which of the following represents the sequence of an RNA transcript for which the template strand of…

A: The deoxyribonucleic acid (DNA) is the nucleotide sequence that stores the genetic information of an…

Q: You may wish to consult the genetic code above to answer the following question. A mutation has…

A: Missense mutation is the mutation in which single amino acid change occurs. The other amino acid in…

Q: The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’…

A:

Q: Which of the following is the MRNA coding for the peptide trp-met-gly- ser-his? A.…

A: The genetic codes are the sequence of nucleotide that governs the formation of proteins.

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…

A: Introduction Transcription is a process by which mRNA is produce from DNA. Once the mRNA is formed…

Q: then translate the resulting mRNA using the gentic code table below. Choose the correct sequence of…

A: The flow of genetic information in cells from DNA to messenger RNA ( mRNA) to protein is identified…

Q: How many open reading frames are present in the following mRNA sequence? You may find the codon…

A: An open reading frame in molecular genetics describes the part of your reading frame that has the…

Q: Using the table above and the mRNA transcript AUG-CUC-UAC-AAG-UAG, choose the false statement: XXX…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the…

A: Introduction The process of duplicating a DNA molecule is known as DNA replication. When a cell…

Q: Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: The RNA is produced from the template strand of DNA by the transcription process that occurs within…

Q: give the amino acids specified by the following bacterial mRNA sequences. a. 5′…

A: In the given question, the bacterial mRNA sequence is given for which we have to find the amino…

Q: Complete the table below showing the sequences of DNA, MRNA codons, RNA anticodons and the amino…

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: A…

Q: A small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1.…

A: Translation or protein synthesis is the third major step of the central dogma of life. mRNA…

Q: Part of the protein-coding region in a gene has the base sequence 3-…

A: Adenine (A), cytosine (C), guanine (G), and thymine (T) are the four nucleotides that makeup DNA…

Q: Translate the following mRNA into protein, starting from the first initiation codon:…

A: Translation is the process of synthesis of protein from an mRNA. mRNA synthesized through…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: The following gene sequence of nucleotides is found on the template (non-coding) strand of a…

A: The sequence would be opposite to template strand and similar to coding strand(except the thiamine…

Q: Which of the following statements regarding the genetic code is false? The genetic code is…

A: Genetic code is used for ways in which the four bases of DNA- - the A, C, G, and Ts- - are hung…

Q: For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and…

A: Translation is a technique which refers to the process of translating mRNA sequence into amino acid…

Q: Using the mRNA codon table below and your knowledge of transcription and translation, complete this…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: The following sequence is the coding strand of a piece of DNA. Type out the corresponding template…

A: The protein sequence can be decoded by a coding or template DNA given. The mRNA strand is the same…

Q: Consider the following gene with their respective introns and exons   5’ –…

A: Since you have asked multiple questions, we will solve the first three question for you. If you want…

Q: Write down the complementary mRNA sequence for each of the following DNA sequence. A:…

A: If template sequence of the DNA is A..   mRNA is .. AUGGAUCGCGUGUACAUCCACCCGUUUCAA

Q: Need help to answer the following questions. Not sure if my answers are right.

A: DNA has a double helix structure. Both the strands are antiparallel that is if the one strand has 3'…

Q: How many amino acid are in each of the two polypeptides produced? And how many nucleotides long…

A: The amino acids are produced by the DNA (deoxyribonucleic acid) through processes called…

Q: A small section of a gene for a protein has the following nucleotide sequence: GGC TCG GTA ACA TAC…

A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…

Q: Below is an mRNA sequence for a short peptide called Lstqz. The nucleotides of the mRNA for Lstqz…

A: This mRNA sequence have so many genetic code. There are some numerical value on genetic code but all…

Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…

A: "Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Q: The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3'

A: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3'   As following the rules in Genetic code the…

Q: Here is a DNA sequence that codes for an extremely short protein. 3' TTACGTGCCGATCGAA 5' template…

A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…

Q: Here is an mRNA sequence (written 5' → 3') A G G G A G G U A A C A G 14 15 16 17 18 19 20 21 24 27…

A: The translation initiation codon is the 5'-AUG-3'. From this codon the first amino acid is…

Q: An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon,…

A: The central dogma describes the flow of genetic information. It states that genetic information in…

Q: Analyze the following amino acid sequence and write down a potential mRNA sequence from which this…

A: The translation is a process by which ribosomes in the endoplasmic reticulum synthesize proteins…

Q: When a triplet of bases in the coding sequence of DNA is “GCA,” the corresponding codon for the mRNA…

A: there are two types purines and pyramidines. A=T G=C In case  of mRNA  A=U Thymine is replaced by…

Q: The template strand of a double helical segment of DNA consists of the following sequence:…

A: DNA is composed of nucleotides and it is a double-stranded helical molecule, and each of nucleotide…

Q: Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…

A: Untranslated regions are present in RNA which are transcribed but not translated on either end of…

Q: A mRNA has the following sequence and direction: 5’-AUGUCAACCUAA-3’ What would be the anticodon…

A: Messenger RNA (mRNA) carries the genetic information copied from DNA in the form of a series of…

Q: If the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the…

A: DNA strand – DNA is a Deoxyribonucleic acid. It is made up of two polynucleotide chains which are…

Q: A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the…

A: Amino acids are the organic compounds that contain the amino group (–NH2) and carboxyl group(–COOH)…

Q: the coding strand of DNA has the same sequence as the mRNA, except that there are U’s in the mRNA…

A: an delete the 'C' at position 52   Explanation:  it is the type of frameshift deletion mutation…

Q: Complete the following sentence: RNA splicing removes the non-coding sequences (_----_) from…

A: RNA splicing process helps to translate mRNA into protein.