The estimated size of fusion protein of an antibiotic (540bp) and an anti-inflammatory agent (630 bp). There are an additional 222 bp between the sequences. Assuming the average weight of an amino acid is 114 Da, what is the estimated size of the fusion protein? 53 kDa 44 kDa 59 kDa 159 kDa

The estimated size of fusion protein of an antibiotic (540bp) and an anti-inflammatory agent (630 bp). There are an additional 222 bp between the sequences. Assuming the average weight of an amino acid is 114 Da, what is the estimated size of the fusion protein? 53 kDa 44 kDa 59 kDa 159 kDa

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Related questions

Q: Suppose you performed two BLAST searches, one on the peptide sequence FIDPWE, and another on the…

A: BLAST is a computer algorithm that is available for use online at the National Center for…

Q: Why are some transposons medically important?

A: Certain sequences are repetitive such as satellite DNA, transposable elements, etc. They are studied…

Q: determine if the individual is homozygous for presence of the Alu insertion(++), heterozygous (+-),…

A: Each Alu sub family member assertion locus was assayed by PCR analysis. It is done by using…

Q: Consider the λ bacteriophage DNA molecule as shown in Figure 21.14. Total digestion with the two…

A: DNA or deoxyribonucleic acid is a type of biomolecule. It is a polymer of deoxyribonucleotides…

Q: proteins can interact with DNA through relatively weak forces, such as hydrogen bonds and can der…

A: DNA or deoxyribonucleic acid is the genetic material in all living organisms, both prokaryotes and…

Q: A diploid organism with a 45,000-kb haploid genome contains 21% G residues. Calculate the number of…

A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around each…

Q: Calculate the dynamic programming matrix and the optimal local and global alignment for the DNA…

A: a: GAATTC b: GATTA Scoring:- +2 for a match -1 for a mismatch -2 L for linear gap

Q: Calculate the expected number of times that a given 8-base-pair DNA site should be present in the E.…

A: A bacterial genomic DNA resides inside cells in a highly condensed and functionally organized form…

Q: Estimate the time needed for E. coli RNA polymerase at 37 °C to transcribe the entire gene for a…

A: To solve this question, Average molecular mass of an amino acid is 110 dalton. Average rate of…

Q: In the actual experiment, the researchers used 149 sequences to buildtheir sequence logo, which is…

A: The sequence logo helps in predicting certain gene features. Gene features such as the ribosome…

Q: pMDawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI:…

A: Given: Digestion of a plasmid PMDawn with EcoRI, BamHI, and EcoRI+BamHI are as follows: EcoRI: 20 kb…

Q: Which of the sequences below do you think would most likely be found in an intrinsically disordered…

A: Intrinsically disordered proteins (IDPs) are those that do not have a proper three-dimensional…

Q: a BLASTP

A: Introduction The Basic Local Alignment Search Tool (BLAST) observes districts of nearby similitude…

Q: That's the result of Gel electrophoresis of genomic DNA ( Of genomic DNA extraction experiment),…

A: Agarose gel electrophoresis is mainly used for nucleic acid separation due to its large pore size…

Q: Repeated sequences can be classified according to theirorganization in the genome as well as…

A: The heredity or inheritance is defined as the passing of traits from parents to their offspring. The…

Q: When aligning the three sequences (ATGC, AATC, AATG), one can use a 3-D "Manhattan Grid", with each…

A: ANSWER: ATG-C AAT-C AA-TG

Q: In Figure 18-14, some individuals have unique SNP alleles—for example, the T allele at SNP4 occurs…

A: The mutation is an alteration in the DNA sequence. These mutations arise during cell division while…

Q: Ladder LS KT MV DY JY Ladder 850 bp 550 bp 11 1

A: Gel electrophoresis is the technique that is used to determine the genotype by looking at the…

Q: The specificity of Watson-Crick nucleobase pairing enables the biological information to be encoded…

A: Adenine, guanine, thymine, and cytosine are the nitrogen bases in the DNA. Adenine, guanine, uracil,…

Q: What is the length in basepairs of these sequences? How many base substitutions are there between…

A: The multiple sequence alignment (MSA) involves the alignment of three or greater than three…

Q: How many base substitutions are there between these sequences? Count ONLY the instances where there…

A: Sequence alignment involves the comparison of sequences of a particular gene from various organisms…

Q: The xyz gene product, encoded by a new viral strain, has coresponding human homologs. Blast analyses…

A: Scoring matrix Scoring matrix measures the similarity between two characters in sequence alignment.…

Q: If the bandicoot genome is 3.62 x 109 base pairs, and the "highly repetitive DNA" fraction is…

A: The genome is the entire DNA content (in base pair) of a haploid (n) cell. That means in case of a…

Q: Determine which primer pair is the best choice. • Explain why the other primers are not good…

A: A brief DNA or RNA sequence serves as the template and controls the production of a complementary…

Q: V3 amino acid sequence molecular clone 296 306 314 320 324 charge S1 phenotype** 168.1 CTRPNNNTRKS…

A: The charge on the peptide or protein is due to the presence of acidic or basic amino acids. Acidic…

Q: Oxytocin, a hormone peptide of nine amino acids, is widely used in obstetrics to induce uterine…

A: Oxytocin(OT): It is a 9-amino acid peptide that is primarily synthesized in the neurons of the…

Q: Rice genome contains 30% C on a molar basis. What are the mole percentages of A, G, and T?

A: In a double helical DNA, there are 4 nucleotides are found ATP, GTP, CTP, TTP. In this double…

Q: Assume that the translational error frequency, δ, is 1 x 10–4.(a) Calculate the probability of…

A: mRNAs are used to form protein by translation. The translation is performed using ribosomes, t-RNA…

Q: GTT, AT,GсT стс, Ат, GCс GTT, ATт, сст стс, АТА, СGT T G C CCG CTG, ATA, AC C стт, АТА , С GT GTC,…

A: A primer is a short nucleic acid sequence that provides a starting point for DNA synthesis. A PCR…

Q: Calculating human genome If 1.5 percent of the human genome consists of protein-coding sequences,…

A: All humans have deoxyribonucleic acid (DNA) as constituent genetic material. This biochemical…

Q: The average of a number of closely related but nonidentical sequences is referred to as a(n)…

A: Homologous sequence

Q: Discuss the main similarities and differences in the nucleic acid sequencing methods known as…

A: DNA sequencing is the process of determining the sequence of nucleic acids, which are the basic…

Q: Variable number tandem repeats (VNTRs) are repeating DNA sequences of about 15–100 bp in length,…

A: Forensic science. Criminological science is the use of science to criminal and common laws,…

Q: The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac…

A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…

Q: Assume 2x108 reads of 75 bps long are obtained from a next-generation sequencing experiment to…

A: Next-generation sequencing relies on the continuous sequencing of the genome parts and later…

Q: Low-resolution X-ray diffraction analysis of a protein composed of long stretches of the sequence…

A: Fibroins are insoluble proteins that are present in silk produced by insects, such as the larvae of…

Q: Using the formulae for dsDNA to calculate g/mol: You have a 4110 bp cloning vector Want to ligate a…

A: The average weight of a single DNA bp is 650 daltons. This can also be represented as 650 g/mol (=…

Q: The specificity of Watson-Crick nucleobase pairing enables the biological information to be encoded…

A: The double helical structure of DNA was discovered by Watson and Crick through diffraction studies.…

Q: The E. coli genome has a superhelical density in vivo of about 0.06. Assuming the DNA has 10.5…

A: The writhing number (W) is the number of times the axis of a DNA molecule crosses itself by…

Q: Assuming that 145 base pairs of DNA wrap around the histone octamer 1.75 times, estimate the radius…

A: A histone octamer is the eight protein complex located at the core of the nucleosome and histone…

Q: The human genome contains approximately 106 copies of an Alusequence, one of the best-studied…

A: Alu elements are highly repeated DNA sequences that can be categorized as short interspersed…

Q: Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC What human disease has been connected to this gene?…

A: The given sequence CCACCTGTACCCGGACACACCCTGGTGTCC is a protein sequence that encodes the protein…

Q: In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…

A: Need to find the complementary strand for the given strand.

Q: What are the similarities and/or differences between interpreting Multiple Sequence Alignment (MSA)…

A: Multiple sequence alignment (MSA) is the process or outcome of aligning three or more biological…

Q: Why does the sequence ITLIIFGVIAGVIGTILLI more likely to contain a membrane-spanning sequence?

A: The proteins or peptides that are inserted into the plasma membrane are called integral membrane…

Question

53 kDa

44 kDa

59 kDa

159 kDa

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Looking at each of the fragments (100, 200, 300 base pairs etc.). Why are there so many of the fragments produced by the pure 1.3-kb fragment? (might have to show diagram)
Using the formulae for dsDNA to calculate g/mol: You have a 4110 bp cloning vector Want to ligate a 245 bp insert for molecular cloning. efficient cloning requires that a 1:5 molar ratio of vector to insert is optimal for the ligation reaction. What are the relative weights of vector and the insert DNA necessary in g?
Estimate the time needed for E. coli RNA polymerase at 37 °C to transcribe the entire gene for a 50-kilodalton protein. What assumption or assumptions must be made for this estimate to be accurate?
A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible (100 words max.)
Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC 1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.
TAC-ATA-ACG-CGA-CAA-CTA-AAA-ACT Write the amino acid sequence of the protein that would be formed by translating this plece of DNA. You can use the three letter abbreviations for the amino acid in each box, do not use the name of the full amino acids, Use the abbrevlation of the amino adid exactly as Itswritten in the table (including the appropriate capltalizations For example it your answer for amino acid 1 is"Methionine" you would write MET in the box (not Met or met) Second Later UUU UUUC Phe UCU UAU Ser UAC UAA UAG Tyr UGU Cys U Leu UCA ucG UGC Stop uGA Beop UUG Step UGG Trp G Cuu C cuC CUA CUG CU Leu Coc CCA CG CAU Pro cGu CAC CAA CAG His CGC Arg CGA CGG 1st 3rd letter AUU A AUG AUA AUG ACU le AAU AAC AGU ACC Asn Ser U leBer ACC ACA Mct ACG The AAA AAG ACA Lys AGG Arg acu Val GCC GCA GCG GAU GAC GAA GAG GOU GGC GGA GGG Arp G GUC GUA GUG Ala Gly Glu Seovence of the protein, 1st amino acid. 2nd arnino acid: 3rd amino acid: 4th amino acid Sth amino acid: 6th amino acid: 7th amino…
Determine the isoelectric point of the peptide product of the mutated sequence: 5' - AUG UCC AUG AUU CUG GAA AUU ACC UCC AUC AUG AAG CGC UGA CCC AUU AUU AA - 3'
What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Enter just the number, nothing else! Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro- A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible (100 words max.)
For a linear B-DNA molecule of 50,000 kb, calculate (a) the contour length and (b) the length of the DNA as packaged in nucleosomes with linker histones present.
Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
Compute the PERCENT IDENTITY for the following pairwise sequence alignment. ACTGATGGGGG--AGACGTA ||||| ... I ||||||| ACTG--AAAAGCTAGACGTA
Representations of sequencing chromatograms for variants of the a chain of human hemoglobin are shown here. Match each of the variants with the corresponding amino acid change. You can use the codon table to decode each amino acid sequence. For example, the first triplet encodes for Val. Normal Chongqing ddATP ddCTP ddGTP ddTTP Pro to Thr Gly to Asp Leu to Arg Karachi Swan River Answer Bank Ala to Pro Asp to Gly Pro to Ala Arg to Leu Asp to Asn Arg to Val