The specificity of Watson-Crick nucleobase pairing enables the biological information to be encoded and passed down through generations of cells and organisms. This specificity arises from the chemical structure of the base pairs, namely the pattern of hydrogen bond donors and acceptors that stabilize only two pairing interactions] relative to the others. How many possible pairwise interactions could potentially exist at a single position within a sequence, including the correct pairs, and all possible other combinations of DNA bases?

The specificity of Watson-Crick nucleobase pairing enables the biological information to be encoded and passed down through generations of cells and organisms. This specificity arises from the chemical structure of the base pairs, namely the pattern of hydrogen bond donors and acceptors that stabilize only two pairing interactions] relative to the others. How many possible pairwise interactions could potentially exist at a single position within a sequence, including the correct pairs, and all possible other combinations of DNA bases?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 14QP: State the properties of the WatsonCrick model of DNA in the following categories: a. number of...

See similar textbooks

Similar questions

The specificity of Watson-Crick nucleobase pairing enables the biological information to be encoded and passed down through generations of cells and organisms. This specificity arises from the chemical structure of the base pairs, namely the pattern of hydrogen bond donors and acceptors that stabilize only two pairing interaction relative to the others. How many possible pairwise interactions could potentially exist at a single position within a sequence, including the correct pairs, and all possible other combinations of DNA bases?
proteins can interact with DNA through relatively weak forces, such as hydrogen bonds and can der Waals interaction, as well as through stronger electrostatic interactions such as ion pairs. Which types of interaction predominate for sequence specifics DNA binding proteins and for sequence independent binding proteins?
In the Watson-Crick model for the DNA double helix (B form) the A-T and G-C base pairs share all but one of the following properties. Which is the exception? None of the proton-binding groups in the purine and pyrimidine bases is in its charged or ionized form. The plane of the base pair is roughly perpendicular to the axis of the helix in each case. The number of hydrogen bonds formed between the two bases of the base pair is the same. O The distance between the two glycosidic (base-sugar) bonds is the same in both base pairs, within a few tenths of an angstrom.
What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Enter just the number, nothing else! Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro- A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible (100 words max.)
Explain how DNA-binding proteins can make sequence-specific contacts to a double-stranded DNA molecule without breaking the hydrogen bonds that hold the bases together. indicate how, through such contacts, a protein can distinguish a T-A from a C-G pair. indicate the parts of the nucleotide base pairs that could form noncovalent interactions— hydrogen bonds, electrostatic attractions, or hydrophobic interactions -with a DNA-binding protein.
In the Watson-Crick DNA base pairing model, Adenine (A) binds to thymine (T), guanine (G) binds to cytosine (C).Draw the structures of thymine and adenine stabilized by Watson-Crick base pair interaction. Also draw the structure of the amide group of glutamine in an interaction of this T-A pair in a way that maximally satisfies the hydrogen bonding capacity of amide.
Draw the structure of the following DNA sequence (5’-AG-3’) hydrogen bonded through Watson-Crick base pairing to the complementary PNA sequence (Cterminus-TC-Nterminus). Make sure to include both the sugar phosphate backbone of your DNA sequence, as well as the peptide backbone of your PNA sequence. DNA: 5’-AG-3’ PNA: (C)-TC-(N)
The sequence of the 15 bp fragment from the previous problem is repeated below: 5' TCTGAATTCCGTAGA 3' There should be a total of hydrogen bonds, N-glycosidic bonds, methyl (-CH3) groups, and (assuming "Watson-Crick" dimensions) helical turns in this double-stranded DNA fragment.
Base analysis of DNA from maize (corn) shows it to have 23 mole percent cytosine (moles per 100 moles total nucleotide). What are the percentages of the other three bases?
A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible（100 words maximum）
Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human - globin gene (shown in the figure below (Links to an external site.)) into bacterial cells, hoping the cells will express it and synthesize functional - globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does -globin made by a eukaryotic cell. Explain why and give thoughts as to how to overcome this.
A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 °C. If an RNA duplex oligonucleotide of identical sequence (substituting U for T) isconstructed, will its melting temperature be higher or lower?