oth DNA (D) and RNA a. What is the KM b. What is the KM C. What is the Vm d. What is the Vm e. On the graph, c noncompetitiv f. On the graph, uncompetitive
Q: Which of the following statements about DNA is true? (Select all that applied) Select one: O a. DNA…
A: Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that coil around each…
Q: che wild type DNA sequence reads THE CAT ATE THE BIG RAT, what type of mutation would change the…
A: Any heritable permanent change in the DNA (deoxyribonucleic acid) sequence is referred to as a…
Q: According to Chargaff's observations of nucleotide composition of DNA samples OA % of (G + C) + % of…
A: Chargaff's rule has been stated for the DNA, which states that the ratio of purine and pyrimidine…
Q: Stacking of bases in B form DNA 1. Is mostly interstrand. 2. Occurs due to Van der Vaals…
A: Base stacking is an arrangement of bases in the 3D structure of DNA.
Q: . Viroids are O A. Causes swine flu O B. None of the above O C. misshaped protein molecules O D.…
A: Subviral particles are infectious agents that are smaller and simpler than viruses. They resemble…
Q: What was the purpose of transferring the +DNA and -DNA tubes from ice to hot water bath to ice…
A: Heat shock is the method use for transformation of plasmid DNA into Ecoli. It consists of a foreign…
Q: DNA → TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG CTG ATC RNA → rotein → DNA → ACC CGA TAC CTC…
A: The synthesis of m RNA from DNA is called transcription. The synthesis of protein from RNA is called…
Q: DNA A= 5' GGG GCT AGC CCC 3' DNA B= 3' ATA TAT ATA CCC 5' DNA C= 5' TAC GTT ACG TCG 3' DNA D= 3' ATC…
A: DNA is a hereditary material that is made up of adenine Guanine Cytosine and Thymine. As it is a…
Q: Writing a Full Strand: 1. A. Original DNA: CCT ATA TCT CTC TAT ATC TCT CAT ACT GTG TGT CTC TAT…
A: DNA It is a nucleic acid which carries genetic information that gets passed from one generation to…
Q: Give the COMPLIMENTARY DNA strand. 3'TAC TAC TTT AMA TCA CTC TCC GCT GGT GTG AGT TGC CCT ACT 5
A: Deoxyribonucleic acid or DNA is a biomolecule composed of two polynucleotide chains that coil around…
Q: A nucleotide sequence in a segment of a DNA information strand is given here. Sketch (A) the…
A:
Q: Regions of DNA that are most easliy unwound have
A: A nucleotide is formed by nitrogenous base, sugar and phosphate. Commonly found bases in DNA and RNA…
Q: DNA fragments cut by restriction enzymes can form two types of ends. What are these ends called? •…
A:
Q: Give the complementary strand of DNA to the following strand, and then the RNA strand based off the…
A: DNA is made of two strands linked together by hydrogen bonds. Complementary base pairing occurs…
Q: OTPDI Ə g TITM d. The viral DNA will be rodioactive e. The viral proteins will be radioactive. 48.…
A: Introduction :- Transfer RNA is an adapter molecule made up of RNA with a length of 76 to 90…
Q: The diagram below shows an autoradiograph ofa DNA sequencing gel. Write the 5' to 3' sequence of the…
A: DNA sequencing is a method used to determine the organism’s actual DNA. The most commonly used DNA…
Q: Select all that are true about DNA gel electrophoresis O This technique can be used to separate DNA…
A: The gel electrophoresis is routinely used technique in molecular biology laboratories that helps in…
Q: NAME CENTRAL DOGMA A c 6 A I A c G. c I A A CT EMPLATE RNA id chein M RNA) takes Difference bl DNA…
A: DNA serves as Genetic material in most of the organism .It helps in transfer the information to…
Q: Chemicals used in transferring of pure DNA to plant cell is
A: When DNA enters into plant cell then it leads to formation of transgenic plants. This technique is…
Q: then he has to chop it up Dr. A. Zion wants to study the flight gene of birds. In order to study the…
A: Information Given: Zion wants to analyse DNA sample of a bird from it's flight gene 1st blank: First…
Q: The DNA strand whose complementary RNA contains a stop codon starting at the 5' end DNA A = 5'…
A: In our body genetic information is stored in form of DNA. DNA can be converted to RNA by…
Q: The proteins and other substances that bind to the DNA rely mostly on non-covalent interaction to…
A: This statement is true. The proteins binds to DNA are of two types the histone and the non histone…
Q: Which is the best definition of a genetic mutation? An error in a code. OA mistake during copying.…
A: A Mutation happens when a DNA gene is harmed or changed so as to adjust the hereditary message…
Q: The dideoxynucleosides ddATP, ddTTP, ddGTP, and ddCTP were important in DNA sequencing because they…
A: Dideoxynucleotides are DNA polymerase chain-elongating inhibitors used in the Sanger technique of…
Q: Levene thought ___ was the heredity molecule. A. carbohydrates B. DNA C. proteins D. RNA
A: BASIC INFORMATION PROPERTIES OF GENETIC MATERIAL It should be stable both chemically and…
Q: Chargaff rule applies to a ss RNA b All Polynucleotides c ssDNA d dsDNA
A: Chargaff rule was stated by Austrian born chemist Erwin Chargaff. The specifies about the 1:1 ratio…
Q: fa restriction endonuclease recognizes and cleaves a linear piece of DNA and Circular DNA at 8…
A: Restriction endonuclease These are also known as restriction enzymes. These enzymes have been…
Q: A Original DNA CCT ATA TCT CTC TAT ATC TCT CAT ACT GTG TOT CTO TAT Complementary DNA B. Make lenteal…
A: Since you have asked multiple questions , we will solve the first question for you. If you want any…
Q: Yu raach aitantin a ab tht studies mucleic acids. Your advisor gave you four tubes for analysis.…
A: Each organism have a genetic meterial by which they regulate, inherited and constant their…
Q: Fill in the blanks: DNA fragment A is 3' AGC CCG CTC CGA GGC TAA AAG CGT 5' is % of guanine in DNA…
A:
Q: Which of (a)-(d) is complementary to the DNA segment 5'-ATGAGCCAT-3'? * O 5'-TACTCCGTA-3' O…
A: Deoxyribonucleic acid: The replication of DNA involves the production of new molecules that have a…
Q: DNA TEMPLATE: 3 'GCA TTT GAT AAA TAC CTG AGA TGA CTG ATT GGG GGC AAA 5' 5' CGT AAA CTA TTT ATG GAC…
A:
Q: is a single stranded RNA molecule held together by hydrog bonds. Answer: MRNA Which of these DNA…
A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…
Q: The elongation of leading strand during DNA synthesis a. progresses away from the replication fork.…
A: Deoxyribonucleic acid (DNA) is a molecule consist of two polynucleotide chains that coil around each…
Q: CI has more binding capacity to the DNA than CRO- Justify the statement.
A: A competition between two genes determines cell fate: the lambda repressor (cI), which is…
Q: Chemical agents can cause mutations by ethylating guanine residues in DNA. Would that be true or…
A: Mutations are the inheritable changes in the DNA. These mutations can change the sequence of DNA by…
Q: PER product (Hbp 2 or Ap D) Puri Fied DNAS PETR gest Digested DNAS Ligate Plate e.cob HpD Transfurm…
A: Digestion of any DNA occurs by the exonucleases or endonucleases. The DNA ligases act as the…
Q: b. Now do this AGAIN assuming that the DNA and RNA templates are read right to left. DNA strand DNA…
A: The mRNA is produced from the DNA template by the transcription process and then mRNA is used for…
Q: In gel electrophoresis, the smallest DNA fragments will travel the farthest. Why does this…
A: Electrophoresis is a laboratory technique used to separate DNA, RNA, or protein molecules based on…
Q: Compared to DNA, RNA; a) Uses thiamine b) Has an OH group on the 3' carbon and DNA does not Oc) Is…
A: DNA or Deoxyribonucleic acid is the genetic material that is passed from one generation to another.…
Q: The technique of gel electrophoresis gives scientists an effective way to see some differences…
A: DNA stands for deoxyribonucleic acid. It is a double helix made up of two polynucleotide chains that…
Q: In a DNA molecule, a sugar, phosphate, and nitrogenous base are collectivley referred to as A. DNA…
A: Nucleic acid is a long chainlike molecule composed of nucleotides found in cells of all living…
Q: At the DNA level, a mutation in a protein coding region where a single base is replaced by another…
A: Mutation is the abrupt change that occurs in the sequence of DNA resulting In altered phenotype.…
Q: 30 The name of the small DNA fragment used to determine if the complementary sequence is present in…
A: The name of the small DNA fragment used to determine if the complementary sequence is present in…
Q: A scientist isolates the DNA genome from a virus. She attempts to carry out a melting analysis but…
A: Introduction: DNA is a type of nucleic acid that is present in the nucleus of the cell. It is the…
Q: B. Make identical strands of DNA CCTAT ATCTC TCTAT ATCTC TCATA CTGTG TGTCT CTATA (original) (new) C.…
A: The newly synthesized strand would always be complementary to the original DNA (and with opposite…
Q: 2) Create an mRNA strand based on the given DNA template strand: TACTT CCTATTITCT TGTCA CCGCACT TIT
A: Messenger RNA (mRNA) is a single-stranded RNA molecule that is complementary to one of the DNA…
Q: Gene cloning vectors should have the property of self-replication so that DNA insert can be copied…
A: Cloning means to make copies in large amount of the cell which have the same genetic make i-e the…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Step by step
Solved in 3 steps
- 5'-[seq]-3' The diagram shows the results of gel electrophoresis for Sanger sequencing. The wells are represented by open boxes and the DNA bands are represented by black boxes. The wells are labeled to show which dideoxy reaction was loaded into each. Write the sequence of the original template strand used for this sequencing reaction, with the 5’ end on the left and the 3’ end on the right.ersonal/eenongen_my_tnstate_edu/_layouts/15/doc.aspx?sourcedoc={a6b083c9-a226-4c31... ☆ Search (Option + Q) Review View Help Picture Editing A В ... During nucleic acid hybridization, the probe is labelled Question 1 options: for DNA stability to increase probe-test DNA binding to identify the location of probe and the test DNA binding for amplification Question 2 6. 9. 10 IV 13 14 Which of the following best describes the trait in the pedigree? Question 2 options: X-linked dominant X-linked recessive autosomal domiant autosomal recessive ONFigure 9.10 You isolate a cell strain in which the joining together of Okazaki fragments is impaired and suspect that a mutation has occurred in an enzyme found at the replication fork. Which enzyme is most likely to be mutated?
- 1d) Whether done manually or automated, DNA sequencing gels are always made of polyacrylamide rather than agarose. Why can't agarose be used for a sequencing gel, as it is for other DNA gel electrophoresis?12:26 AM E G M 46 l i72% SCIG10_ACTIVITYSHEET_Q3W4.pdf Let's Evaluate: A. Multiple Choice: Encircle the letter of your chosen answer. For numbers 1-3 refer to the statement: The following is the base sequence on one strand of a DNA molecule: AAT GCC AGT GGT 1. If this strand is replicated, which of the following is the complementary strand that is produced? A. TCG TCC GTC TAG C. TTA CGG TCA CCA B. AGC AGG CAG GGT D. UCG UCC UCU AGA 2. If transcribed into an mRNA, what would be the resulting strand? A. UUA CGG UCA CCA C. AGC AGG CAG AUC B. AGC AGG AGA T C D. TCG TCC GTC TAG 3. During translation, the tRNA sequence of nucleotides arranged linearly is A. TCG TCC GTC TAG C. AGC AGG CAG AUC B. AAU GCC AGU GGU D. UCG UCC GỤC UAG 4. How many codons are needed to specify three amino acids? В. 6 А. 3 С. 9 D. 12 5. Some events that take place during the synthesis of a specific protein are listed below. I. Messenger RNA attaches to a ribosome. II. DNA serves as a template for RNA production. III.…12:49 0 14. You want to amplify the DNA between two stretches of sequence shown in the figure below. Explain which one of the following primer pairs would allow you to amplify the DNA by PCR. DNA to be amplified 5'-GACCTGTGGAAGC -CATACGGGATTGA-3" 3'-CTGGACACCTTCG GTATGCCCTAACT-5" primers (1) 5'-GACCTGTCCAAGC-3 (2) 5-CTGGACACCTTCG-3 (5) 5-CATACGGGATTGA-3" (6) 5°-GTATGСССТААСТ-3° (3) 5'-CGAAGGTGTCCAG-3' (7) 5'-TGTTAGGGCATAC-3" (4) 5'-GCTTССАСАGGTC-3° (8) 5'-TCAATCCCGTATG-3' END 5 THE END
- HindlII ECORI ECORV BamHI 379 Sall Pstl. tet amp Plasmid PBR322 1000 4361 bp ori Ndel If you were going to use this vector to clone a foreign fragment of DNA, what two restriction enzymes would you use to cut the vector, so you could make a recombinant plasmid that has AmpR and KanR (Kanamycin resistance), but No TetR. Assume the insert DNA does NOT have a Tet resistance gene but does have a Kanamycin resistance gene. O EcoR1 and Hindll O Pst1 and Sal1 O Pst1 and Nde1 O EcoR1 and Nde1 f6EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .1_30*_SP23 - General Biology I (for majors)/1 of us page The anticodon sequence created from the following DNA: TACGGGGCTGAGATT F1 Select one: O a. Tyr-Gly-Ala-Glu-lle O b. AUGCCCCGACUCUAA c. UACGGGGCUGAGAUU O d. Met-Pro-Arg-Leu-STOP F2 # 80 F3 $ 000 000 F4 % F5 MacBook Air F6 & r F7 DII F8
- 5’-GATCAGCTGACTGGATCCGTCCTCAACGTCAGGATCCAGCTTCAAG-3’ 1. How many cuts do you expect this enzyme to make on the above DNA and how many fragments do you expect to see on your gel? Assume that they are all different sizes.Why is the company Qiagen has more refined DNA extraction steps than a normal Strawberry DNA extraction practical? Summary of Qiagen DNA extraction steps Add ATL buffer and grind with sample. Add 20 microliters of enzyme Proteinase K to degrade protein into a 1.5-2ml microcentrifuge tube. Add 200 microlitres AL lysis buffer, and mix by vortexing for 5–10 seconds, which breaks cell membrane allowing DNA to be released. Incubate the sample at 56 degrees for 10 minutes. Mix the cell lysate with 200 microlitres ethanol by pipetting it at the side of the microcentrifuge wall so DNA precipitates. The DNA forms a white layer and the remaining liquid is discarded. Pipet the mixture into DNeasy Mini spin column placed in a 2 ml collection tube. Centrifuge for a minute at 8000 rpm. Place the mini spin column into a 2 ml collection tube, add 500 µl Buffer AW1, and centrifuge for 1 min at 8000 rpm. Then add it to a new 2 ml collection tube (provided), add 500 µl Buffer AW1, and centrifuge for 1…11:29 Protein 6-10092015113530.pdf https:api.schoology.comv1attachment169963838... Name Class Date 2. How are enzymes involved in this process? 3. hаppens anzips"? 4. Why is it important that exact copies of DNA be made? 5. Suppose that a sequence of one DNA strand is T-A-C-A-A-C-G-T-G. What is the corresponding sequence on the other strand? E Concept Mapping The construction of and theory behind concept mapping are discussed on pages vil-ix in the front of this Study Guide. Read those pages carefully. Then consider the concepts presented in Section 7-1 and how you would organize them into a concept i page 74. Notice that the concept map has been started for you. Add the key Now look at the concept map for Chapter 7 on concepts you are important Secti When you have finished the chapter, you will have a completed concept map. 69 1 of 1