List down the protected areas in REGION 12 (Soccsksargen), PHILIPPINES and the endemic species present in each identified protected area. (Minimum of 5 protected areas and at least 3 endemic species per area.).
Q: What are the principle and basic concepts of Simple staining
A: The simple staining doesn't give a lot of data about the cell separated from the bacteria'…
Q: What is the history of birth rates?
A: The birth rate is also relatable to the term referred to as Natality. The birth rate is defined as a…
Q: Outline the structure and function of the brain, spinal cord, peripheral nerves and the autonomic…
A: Function of Brain:- Central coordinating center of the body. Place of association areas and all…
Q: David isolated 3 unidentified strains of bacteria from a patient's wound. He wants to determine if…
A: Lysogeny is the state where a host cell contains one or more prophages and lysogenic cells contains…
Q: The urine of an infant gives a positive reaction with 2,4 dinitrophenylhydrazine. Mass spectrometry…
A: Mass spectrometry It is a analytical tool use for measuring mass to charge ratio.
Q: Purified proteins can have their mW determined by: Ethanol precipitation O SDS-PAGE O going to taco…
A: The application of scientific and technical principles to the processing of the material by…
Q: Which of the following is not true regarding DOGEMs sequencing? it could result in more than one…
A: Answer :- Option (A) is correct. - It could result in more than one complete phage genome sequence.
Q: Choose 1 biotechnology product in the field of medicine or agriculture. Provide a 1-2-minute…
A: Science is humanity's greatest blessing. It has altered human existence; nothing finer could have…
Q: Match the following hormones with their actions: ACTH epinephrine testosterone ADH estradiol…
A: INTRODUCTION Answers to question 1-10 is given below.
Q: Briefly explain the generation and conduction of nerve impulse.
A: Introduction Neurons:- It is the structural and functional units of the nervous system of humans…
Q: Using the table below, differentiate the effect of two varying pH levels (as indicated by by the…
A: Enzymes are affected by changes in pH. The most favorable pH value - the point where the enzyme is…
Q: He then ran the sample on an agarose gel and observed a strong band at approximately 400bp. What…
A: The band represent a small piece of DNA that was cut with restriction endonuclease and then…
Q: For your 25ul ligation reaction: You need to add 160ng of your digested insert DNA (which is at a…
A: Given: Total volume - 25ul. The DNA need to be added is 160 ng. One ul contains 160 ng of digested…
Q: Now, solve the following problems involving radiation: 1. Why is 1 mGy of alpha radiation considered…
A: Alpha particles is double ionized helium He++ ion. The beta particles is electron like elements.…
Q: Angiotensin is a hormone that stimulates vasoconstriction and increases blood pressure. Which effect…
A: Answer :- Option (D) is correct. - decreased reabsorption of sodium in the kidneys.
Q: ALL ANSWERS MUST RELATE TO THE NATION CHILE 4- Biosphere / Environmental Sustainability Challenges:…
A: Ans: Chile is a Latin American country and comes under the 35 world's biodiversity hotspots due to…
Q: populations of flightless grasshoppers (Population A and B) are separated by a river that contains…
A: This is a type of natural selection occurring here. Natural selection was a concept given first by…
Q: of most hemoglobins when: 1. deoxygenated blood enters the capillaries in the lungs. 2. oxygenated…
A: Answer :: Hemoglobin-oxygen dissociation curve as the name suggests describes the relation…
Q: 16. In amphibian embryos, BMPS act on ectodermal cells in concert with Wnts to form the epidermis.…
A: Developmental biology describes how interacting mechanisms generate an organism's various size,…
Q: Choose 1 biotechnology product in the field of medicine or agriculture. Provide a 1-3 minute…
A: Biotechnology is a branch of science concerned with the use of biological methods for the benefit of…
Q: What are the principle and basic concepts of SMEAR PREPARATION? (please explain it thoroughly in a…
A: Introduction A smear is a small amount of culture spread in a very thin film on the surface of the…
Q: Calculate the estimated population size, N, given a study that initially marked 100 animals and…
A: (11) The method of estimation is called the Lincoln Index P = (N1 x N2 )/ R. P = total size of…
Q: Describe how presynaptic targets can be regulated to affect neurotransmitter release at the…
A: Definition of Synapse: The specialized junction at which a neuron communicates with a target cell…
Q: Consider a situation where you have a parental cross with the mother and father phenotypes listed…
A: Introduction:- Inheritance is the process of genetic information being passed down from parent to…
Q: 2. Calculate the following: a. you are asked to prepare 10 NA slants and 5 NA stab in big tubes. How…
A: Growth media also known as culture media are used to cultivate microorganisms. These media are a…
Q: Upon what principle does bactofugation depend? Why might its use be desirable in processing milk…
A: Bactofugation is a centrifugal method for eliminating microbe spores from milk, particularly when…
Q: Fill in the blank part of kidney nephron is illustrated
A: The nephron is a structural and functional unit of the kidneys. Nephrons work to form urine. The…
Q: Question 14 During RNA chain elongation gyrase proceeds ahead of the transcription bubble in order…
A:
Q: 2. An ecologist spent a year studying the population dynamics of a species of duck on a lake. At the…
A: Firstly let's understand what's migration, immigration and emigration. MIGRATION: In ecology,…
Q: What is the relationship between the amount of sodium ions in the blood and nephron function, urine…
A: Introduction Sodium is an electrolyte, which are minerals that the body need in relatively large…
Q: Which of the following is not true about a gram-positive cell wall? It has plasma membrane inside…
A: Introduction :- The Gram-positive cell wall is made up of many interconnected peptidoglycan layers…
Q: ANSWER THE SAME ANSWER ANYMORE. PLEASE INCLUDE REFERENCES I NEED IT. MAKE IT DETAILED IN ONE…
A: Endometrial polyp is abnormal growth after menopause in uterus. But also present unusually in young…
Q: Protein P, normally stimulates apoptosis or cell death when activated. Consider a cell with a…
A: The construction of this question gives us an information about the nature of protein P, P when…
Q: what is the difference between DNA microarray and Fluorescence in situ technique? or is the…
A: Difference between FISH and Microarray Technique Fluorescence In Situ Hybridization It is possible…
Q: In case of a plant virus going viral, what actions do you think should be made to improve our food…
A:
Q: ake a timeline about Microscopic (Organized and Unorganized) Urine Sediments which are significant…
A: Urine analysis refers to a group of clinical tests applied to evaluate the urine sample. Basically,…
Q: 1. How do clams open and close their shells? 2. How does a clam draw water into its mantle cavity?…
A: Clams are bivalves that spend most of their time lying on the seafloor. When frightened, a clam uses…
Q: TRUE or FALSE? Sexual selection can only occur if the features and/or behaviors associated with it…
A: Natural selection is the interaction through which populaces of living beings adjust and change.…
Q: What are initiatives that have to be done lower your household’s vulnerability to climate change
A: Environmental change drives have huge scope efforts to battle an Earth's global warming temperature…
Q: STUDY QUESTIONS 1. List down at least 3 differences in the anatomy of male and female frogs. 2. How…
A: Frogs are amphibians and humans are mammals.
Q: Define the genetic disorder Huntington's disease and the mode of inheritance (Dominant, Recessive,…
A: Answer 1 : Huntington's diseases is the condition in which the nervous cells breaks in the brain…
Q: An isolated population of prairie dogs has longer than average teeth. As a result, they can eat more…
A: A mutation is an adjustment of the DNA sequence of a living being. Mutation can result from blunders…
Q: Please help Why did we use biodegradable nanoparticles? Please use The worksheet below and don’t…
A: Biodegradable Nanoparticles (BNPs) are basically particles with matter of interest (such as gene…
Q: Organisms with favorable characteristics are more likely to survive and pass on their traits to…
A: Variation means genetic differenced between cells, individual organisms or group of organisms.…
Q: What is the name of the site where RNA polymerase binds to the DNA prior to the beginning of…
A:
Q: Choose the best answer. When the environment changes dramatically: All of these answers are true…
A: Species are a group of organisms that can interbreed and give rise to viable and fertile progeny.
Q: Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT
A:
Q: What is the significance of Juxtaglomerular apparatus in kidney function.
A: Urinary system is a part of body system which generally involved in formation of urine and it's…
Q: How can you tell someone’s social class? What indicators can be misleading?
A: A group of members present in a society divided on the basis of their social and economical status…
Q: Helping tags: Biology, microbiology, Vibrio spp. It's a common practice in some countries to eat…
A: Oyster refers to a group of salt-water bivalve molluscs that dwell in marine or brackish…
List down the protected areas in REGION 12 (Soccsksargen), PHILIPPINES and the endemic species present in each identified protected area. (Minimum of 5 protected areas and at least 3 endemic species per area.).
Step by step
Solved in 2 steps with 2 images
- Which of the following is not a part of the red list criteria for "critically endangered" species? The population is expected to decline by 25% or more within 3 years or 1 generation. The species has a restricted range <100km2 at a single location and there is observed or predictive habitat loss, fragmentation, ecological imbalance or heavy commercial pollution. Extinction probably is greater than 50% within 10 years or 3 generations. The total population size is less than 200 mature individuals.Which of the subsequent options is not included in the red list criteria for species classified as "critically endangered"? 1. The population is projected to decrease by 25% or more within a span of 3 years or 1 generation. 2. The species possesses a limited range of less than 100km2 in a solitary location, and there is evidence of or anticipated habitat loss, fragmentation, ecological imbalance, or significant commercial pollution. 3. The likelihood of extinction exceeds 50% within a timeframe of 10 years or 3 generations. 4. The overall population size consists of fewer than 200 mature individuals.Provide 2 Philippine animal and 2 plant species whose status is threatened or endangered. Why are these plants and animals are considered threatened/endangered?
- Look at the conditions on the terms and descriptions or definitions on the right. Match each description or definition to the correct term. species richness low resistance invasive species niche community ( ) ) ) ) L - :: the functional role of an organism in the environment :: measurement of the number of species present :: a pine forest that catches fire easily :: the location occupied by a species in the environment :: the living things of one species in an environment composed of all species living in the environment :: an introduced speciesMatch the following species status to these species in Canada. Endangered Extirpated Special Concern Threatened Extinct Not at risk 1. American Badger (Taxidea taxus jacksoni) 2. Bear's-foot Sanicle (Sanicula arctopoides) 3. Rocky Mountain Sculpin (Cottus sp.) Westslope populations 4. Eelgrass Limpet (Lottia alveus alveus) 5. Four-toed Salamander (Hemidactylium scutatum) 6. Frosted Elfin (Callophrys irus)Visit the website of International Union of Conservation of Nature (IUCN) and open the Red List of Threatened Species, https://www.iucnredlist.org/. Research a species (plant or animal) of your choice, submit your findings containing the following information: Species name and picture UICN status Species origin Population size Threats Conservation Action
- Match the following descriptions with the correct U.S. environmental legislation. Group of answer choices Law that requires government to promote multiple uses of our Federal Forests [ Choose ] National Recovery Act Endangered Species Act Federal Forest Act National Forest Management Act National Environmental Policy Act National Species Plan Law that requires the government to develop a Recovery Plan for any species that is endangered or threatened [ Choose ] National Recovery Act Endangered Species Act Federal Forest Act National Forest Management Act National Environmental Policy Act National Species Plan Law that requires the writing of an Environmental Impact Statement for projects on Federal Lands [ Choose ] National Recovery Act Endangered…Please help me answer this in 10 sentences only. In the Convention of Biological Diversity (CBD), the precautionary principle read “when there is a threat of significant reduction or loss of biological diversity, lack of full scientific uncertainty should not be used as a reason for postponing measure to minimize or avoid threat”. What is the application of this principle to straddling fish stocks and migratory fishes? Thank you very much for your helpIf the statement pertains to a threatened species, put an x in the threatened column. If the statement pertains to an endangered species, put an x in the endangered column. If neither column applies, leave the line blank
- Match the approach to protection with the example from the academic literature. Species approach Hotspot approach Ecosystem approach 1. Wolf reintroductions into the Yellowstone environment restored riparian species and increased biodiversity because wolves controlled the numbers of elk and coyotes which allowed plants, beaver, and foxes to rebound (Ripple and Beschta 2003). 2. The creation of a reserve protects the red-brown treecreeper (Climacteris picumnus). This approach looks to accommodate processes that threaten species viability, such as fragmentation and feral predators (Nicholson et al. 2013). 3. Species richness of tiger beetles, Cicindelidae, is positively correlated with bird and butterfly diversity across North America, Australia, and the Indian subcontinent (Reid, 1998).Bob Davison describes the Endangered Species Act (ESA) as an effective tool for conserving biological diversity. What is his rationale for the value of focusing on individual species? The public is not concerned about the economic costs of individual species recovery. A focus on individual species is cheaper than protecting entire ecosystems. Establishing public empathy for charismatic species provides an opportunity to educate people about lesser-known species. The public tends to value intact ecosystems over particular plant and animal species.Which one of these statements about COSEWIC is false? COSEWIC's assessments take into account political, social and economic factors. The Species at Risk Act (2002) established COSEWIC as an advisory body. The committee made its first designation in April 1978 and has met annually since then. Members of COSEWIC are wildlife biology experts from academia, government, non-governmental organizations and the private sector responsible for designating wildlife species in danger of disappearing from Canada.