Q: features of adaptation” may influence program design for a given population.
A: What Features of adaptation in animals leads to influence the population?
Q: How many NADH, FADH2, NADPH and ATP will be generated when breaking this fatty acid down into…
A: Fatty acids are broken down into acetyl-CoA by beta-oxidation within the mitochondrial matrix and…
Q: BHI TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT M13-20 primer binding site Bsp 1061 goi Primer design…
A: It is required to use oligonucleotide primers while conducting a PCR reaction. Designing primers…
Q: Besides real time PCR, Shania will also be using other variations of PCR; Multiplex PCR, Reverse…
A: Multiplex PCR used in temperature-mediated DNA polymerase in a thermal cycler. Multiplex PCR is…
Q: 26) Eukaryotes are unable to couple transcription and translation because: A) the two processes…
A: Introduction: RNA serves as a template for the production of proteins. Aligning the set of…
Q: Which of the following labeled cells in the photomicrograph shown synthesizes antimullerian hormone?…
A: Anti Mullerian Hormone It refers to the hormone that is responsible for the development of…
Q: 18. The amino acid sequence is matched with three bases on mRNA codon or DNA codon (pick one). 19.…
A: Please follow step 2 for detailed explanation.
Q: A shuttle vector is a vector constructed so that it can propagate in two different host species. One…
A: Shuttle vector It refers to a vector—typically a plasmid—built to replicate in two separate host…
Q: You finally received the gene sequence of a novel bacterial isolate. The supervisor required you to…
A: Bioinformatics is the study and use of biological information's complexities. Bioinformatics…
Q: A tumour inducing plasmid shown in Figure 2 is isolated from a soil bacterium. (i) Auxin Left Border…
A: A plasmid vector must have a single replication origin, a cloning site (where restriction enzymes…
Q: other diseases like Kwashiorkor Syndrome
A: Kwashiorkor: It is a condition which results from the inadequate protein intake. Initial symptoms…
Q: What do the terms “chains, clusters, pairs, and tetrads” refer to in the arrangement of bacteria?
A: Bacteria generally multiply via binary fission and results in two identical daughter cells. These…
Q: At higher altitudes, water boils at a lower temperature True False
A: water boils at 100 degree centigrade at optimum conditions. water freezes at 0 degrees at optimum…
Q: Question:- Why do gametophytes not give rise to spores in bryophytes or ferns?
A: The life cycle of plants show alternation of generation in which the plant body alternates between a…
Q: a) Based on this tree is the chicken, mouse, human, or hamster most closely related to the bat? b)…
A:
Q: The size of a DNA fragment that can be inserted into an unmodified λ vector is very limited. Large…
A: One of the earliest biological organisms whose transcriptional regulation was thoroughly…
Q: The ribosome is unique to eukaryotic cells removes introns from RNAs catalyzes the formation of the…
A: Introduction : Ribosomes are known as protein factory, as they help in the synthesis of proteins.…
Q: Write a brief note on ethical usage of animal in pharmacological research? Please answer at your…
A: Animals are used in research to develop medicines and treatment techniques to address illnesses. As…
Q: Below is an image of translation occurring in the direction indicated by the arrow. Use the image…
A: An arrow has been given that signifies in which direction, translation is happening. Translation…
Q: QUESTION 45 Which of the following statements is FALSE? Low oxygen levels in the blood increase…
A: Introduction: The body's cells require energy for metabolism, that is supplied by the blood from the…
Q: A cortical module found in the visual cortex represents what type of visual information? a. All of…
A: Visual cortex The major cortical area of the brain is where visual information conveyed from the…
Q: DNA profiling has been used to verify pedigrees of valuable animals such as show dogs, racing…
A: Eukaryotic genomes contain a significant amount of repetitive DNA that does not code for proteins. A…
Q: Genetically modified foods are products produced from organisms that have had genetic modifications…
A: Biological entities (plants, animals, or microorganisms) in which their genetic material (DNA)…
Q: We modeled Cystic Fibrosis in lab. What is the main problem with someone with Cystic Fibrosis? What…
A: Cystic Abrosis is a multi-sysem Autosomal recessive disorder (GIT, Respiratory system…
Q: Ihsan is a biologist working with the genetics of a psychrophilic bacterium. He cloned an antifreeze…
A: A gene is the basic physical and the functional unit of heredity. They are made up of DNA. Some…
Q: xplain how Protein Data Bank (PDB) can assist Dr.
A: protein data bank it enables science and education by providing access and tools for exploration,…
Q: b) A gene was isolated from mouse and sequenced by a research group. When the sequencing result was…
A: BIOINFORMATICS is an interdisciplinary field of Biology and Technology that involves the usage of…
Q: Oldfield mice that live on beaches of the gulf and Atlantic coast of Florida tend to white, wherease…
A: The oldfield mouse or the beach mouse is a nocturnal species of rodent in the family Cricetidae.…
Q: Examples of ionizing radiation that are able to damage DNA and kill bacteria are Microwaves and…
A: Bacteria Or microbial pathogens can be killed by gamma ray, Ultraviolet rays, Radiowaves of…
Q: The haploid number of chromosomes in a cell of a grasshopper is 18. How many chromosomes are in a…
A: A chromosome is a lengthy DNA molecule that contains all or a portion of an organism's genetic code.…
Q: B cells are most important in the _______ immunity type of _______ immunity.? .A.Cellular;…
A: We know that Immunity is resistance to disease. The two important components of immunity are innate…
Q: If the phylogenetic species concept (PSC) were used to define species, rather than the biological…
A: The phylogenetic species concept is a attempt to explain species by their relationships to other…
Q: Multi-drug resistant tuberculosis is becoming more common because of The age of the hosts…
A: Mycobacterium tuberculosis is the bacteria that is responsible for causing tuberculosis (TB).…
Q: Taxon Outgroup A B C D E Character 1 0 0 0 0 0 1 Character 2 0 0 0 0 0 1 Character 3 0 0 0 0 1 1…
A: Introduction Phylogenetics is the study of links between or among groupings of organisms and their…
Q: Dr. Jace is a research officer in a laboratory that studies anticancer treatment. She is interested…
A: The maintenance of tissue homeostasis and embryonic development both include the natural…
Q: Can someone please help with number 3 and the graph?
A: Carrying capacity It can be characterized as the average size of a species' population in a specific…
Q: Describe two different ways in which we can induce reorganization/plasticit in primary motor cortex.
A: The remodelling of cortically encoded muscle groups discovered by intracortical microstimulation is…
Q: Caenorhabdiris elegant posses motor neurons called MNs. It has been determined that few cells known…
A: Neurons are the fundamental units of the brain and nervous system. These are the cells responsible…
Q: Is a chromosomes a one half of a newly replicated eukaryotic chromosome
A: The eukaryotic chromosomes consist of a DNA-protein complex that is organized in a compact manner…
Q: Differentiate between the following terms used in medical epidemiology: 4.1. Sporadic vs endemic…
A: Sporadic refers to a disease that occurs infrequently and irregularly, it does not show any common…
Q: methods to introduce gene of interest into plant cells for the production of transgenic crops.
A:
Q: 2. Human activity can be very disruptive to an ecosystem. Part of the forest shown in the picture…
A:
Q: If the primers you purchased possessed the following information. Number of Guanine: 5 Number of…
A: Melting temperature of primer depends on AT and GC content and length of primer. There are two…
Q: Which statement best describes the reason maternal recessive CYP1A1 polymorphisms of CYP1A1 decrease…
A: Answer: ...It increases the metabolism of nicotine. ...It increases the metabolism of PAHs.
Q: Explain how medical epidemiology is relevant to clinical practice.
A: Introduction :- Epidemiology is the study of the prevalence and causes of health-related conditions…
Q: Put the following DNA replication events in the correct order: Primase synthesizes an RNA primer. 2
A: DNA replication is the process by which a DNA duplicates itself and forms new strands during the S…
Q: 32. What are the two components of tRNA which are important for building a protein? what are…
A: Ribosomes are the one of the most essential organelle which is known for synthesis of proteins.…
Q: Separation of homologous chromosomes during Meiosis I requires: Select one: a. Removing centromere…
A: A division in which diploid cell reduces the chromosome number into half by cell division and…
Q: In Semi conservative replication: A. After one round of replication of a single molecule of DNA, one…
A: Answer b) After one round of replication of a single molecule of DNA, two resulting DNA molecules…
Q: GloFish Experience the Glo
A:
Step by step
Solved in 3 steps
- A particular triplet of bases in the coding sequence of a DNA strand is AGT. What is the corresponding triplet in the complementary strand of 2 points DNA? O AGT О ТСА O UCA O UGT Poovor tf ho coulLfind the ler Gregor Mondolcovnorimontc couab 9MO1. Draw an accurate segment of DNA with its complimentary strand. (10 points) Make sure to include the hydrogen bonds between base pairs of different DNA strands. 5'-CT-3' art to quo lexorbyd- ods tson ont to guzaris robitoslaun vnem to memylog 18 ablos om buit quors serigaorig art of abnod abitosloun enoof estion 9 t of uestion THCA ▶ Sou 100- HC This reaction is Entropy is THC San Leafly ATA RNA polymerase SSSSSSSSSS ATTOGOGACATAA ATGACGGATCAGCCOCAAG UACUOCCUAGUC RNA Transcript TACTOCCTAGTCGGCOTTCOOCTTAACCOCTOTATIT (In this picture, RNA is being made by complementary base pairing with DNA.) This reaction is → Entropy is ◆
- What is the nucleotide sequence of the complementary strand of this DNA molecule A TGCGA? CATAG O A AT G CGA O TACG CT CCGTTATIf the sequence of one strand of DNA is CTCGGA, the sequence of the complementary strand will be Group of answer choices TCTAGG GGACTC GAGCCT CTCGGA TCCGAGsmolA eno DNA -- THE DOUBLE HELIX (modified from The Biology Corner - Worksheets and Lessons) The nucleus is a small spherical, dense body in a cell. It is called the "control center" because it controls all the activities of the cell. Chromosomes, found in the nucleus, are microscopic, threadlike strands composed of the chemical DNA (short for deoxyribonucleic acid). Chromosomes are composed of genes, which is a segment of DNA that codes for a particular protein which in turn codes for a trait. It is commonly referred to as the gene for baldness or the gene for blue eyes. In 1953, James Watson and Francis Crick established the structure of DNA. The shape of DNA is a double helix, which is like a twisted ladder. The sides of the ladder are made of alternating sugar and phosphate molecules. The sugar is deoxyribose. Color all the phosphates red (labeled with a "p"). Color all the deoxyriboses blue (labeled with a "D"). The rungs of the ladder are pairs of 4 types of nitrogen bases. The…
- Write the complementary sequence of DNA AGCTAT AGCit 6- DNA and Genetics 1/e/1FAlpQLSfi0hfAvlhxzCSiUIl 6rt-nUSboWI73UmWOxkOw80Cwko1ng/formResponse te AB Ab aB ab Key AA - Green AB AABB AABB AABB AaBb Ab AABB AAbb AaBb Aabb BB - Smooth aB AABB AaBb aaBB aaBb aa - Yellow ab AaBb Aabb aaBb aabb ьь - Rough How many offspring out of 16 would be green and rough? * 1 point O 1 O 6 How many offspring out of 16 would be yellow and smooth? 1 point O 10 14A strand of DNA has the sequence 5'-AGTC-3. What is the sequence of the complementary strand in the conventional 5'-3' direction? GACT AGTC TCAG O CTGA
- DNA A= 5' GGG GCT AGC CCC 3' DNA B= 3' ATA TAT ATA TCC 5' DNA C= 5' TAC GTT ACG TCG 3' DNA D= 3' ATC TTT GCA TTA 5' The DNA strand which is most likely to form DNA ZNumbering the fragments left by cutting the DNA with BAM HI from left to right, which fragment will travel the furthest? BAM HI: GGATCC CCTAGG AATCGGATCCATTTGGACTAAAGGACCCGGATTGGATCCAGGGCCTTTAGTACC TTAGCCTAGGTAAACCTGATTTCCTGGGCCTAACCTAGGTCCCGGAAATCATGG O 3 O 2 4. 1.4. Give the ABBREVIATED NAME of the nucleotide in the 3' end. -OCH OwP-OCH -OCH 54 pm E P Type here to search AO 40 ENG 05/11/21