Devonte asked his colleague George to verify his results by repeating the sequencing experiment in a different lab. George was disappointed to find that his gel showed just one DNA band with a fluorescently labeled “G.” What did he leave out of the sequencing mixture? Devonte sequenced a novel gene using the Sanger dideoxy sequencing method. The resulting sequence he determined is shown below. CCGGATCGGGTTTCCGGGAATCGGGGG
Devonte sequenced a novel gene using the Sanger dideoxy sequencing method. The resulting sequence he determined is shown below.
CCGGATCGGGTTTCCGGGAATCGGGGG
Devonte asked his colleague George to verify his results by repeating the sequencing experiment in a different lab. George was disappointed to find that his gel showed just one DNA band with a fluorescently labeled “G.” What did he leave out of the sequencing mixture?
Devonte sequenced a novel gene using the Sanger dideoxy sequencing method. The resulting sequence he determined is shown below.
CCGGATCGGGTTTCCGGGAATCGGGGG
Devonte asked his colleague George to verify his results by repeating the sequencing experiment in a different lab. George was disappointed to find that his gel showed just one DNA band with a fluorescently labeled “G.” What did he leave out of the sequencing mixture?
a)Primer
b)DNA polymerase
![](/static/compass_v2/shared-icons/check-mark.png)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
![Human Anatomy & Physiology (11th Edition)](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Biology 2e](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Human Anatomy & Physiology (11th Edition)](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Biology 2e](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Molecular Biology of the Cell (Sixth Edition)](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
![Laboratory Manual For Human Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
![Inquiry Into Life (16th Edition)](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)