D. Lactate
Q: Which of the following is NOT true regarding nicotine? a. its psychoactive effects include…
A: Nicotine is a toxic substance present in tobacco. Nicotine is addictive and is hard to quit. It…
Q: Using a 1 cm cuvette, the absorbance at 260nm of your double-stranded DNA sample is 0.15. What is…
A: Lambert-Beer's law can be used to calculate the concentration of DNA in a sample. It states that the…
Q: Please identify whether the statements below is true or false. Thank you! (Please put a short…
A: Amino acids are compounds containing carbon, hydrogen, oxygen, and nitrogen. Proteins are polymers…
Q: CASE STUDY # 2 A 2-year-old black girl is being seen by the hematologist after her pediatrician…
A: The red blood cells (RBCs) are the most important blood cells. They are in charge of transporting…
Q: A physician diagnoses an infant patient with a pyruvate carboxylase deficiency in part by measuring…
A: In case of Pyruvate Carboxylase deficiency, body accumulates lactic acid in blood. This is an…
Q: please name and characterize the enzym class according to the given rraction C=O 0. CH ČH-OH C=O Ó.…
A: The given molecule is fructose-1,6-bisphosphate which is broken down to glyceraldehyde-3-phosphate…
Q: why all amino acids except glycine have L and D forms and specify the type of isomerization…
A: Amino acids are the monomeric units of proteins. The general structure of an amino acid has a…
Q: Determine the number of carbon atoms present and the the total number of phosphate groups present in…
A: Glycolysis is a major metabolic pathway in the breakdown of carbohydrates such as glucose.…
Q: Indicate what step each of the events in the glycolysis pathway the following takes place: a. First…
A: Glycolysis is a metabolic pathway which converts glucose into pyruvate.
Q: Reactions and Thermodynamics of Glycolysis
A: Third step of glycolysis, fructose-6-phosphate is converted to fructose- 1,6-bisphosphate by…
Q: Does SARS-CoV-2 conform to the central dogma of molecular biology that was coined by Francis Crick?…
A: Introduction: SARS-Cov-2 is a member of a large family of viruses called coronavirus disease 19…
Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…
A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…
Q: Why people with PK deficiency may tolerate a lower hemoglobin level than people with other types of…
A: Pyruvate kinase deficiency (PKD) is the most prevalent congenital glycolysis enzymatic abnormality…
Q: Q1. (a) Describe and illustrate each of the following immunoprecipitation techniques (i)…
A: a) Immunoprecipitation (IP) refers to the small-scale affinity purification of antigens with the…
Q: (a) Draw the condensed structural formula, and give the name and abbreviation for the dipeptide…
A: Dipeptide is the structure formed by two aminoacids with a single Peptide bond. Anomeric carbon is…
Q: Which of the following is not a similarity between prokaryotic initiation and eukaryotic initiation?…
A: The initiation stage in translation starts with the binding of some initiation factors with the…
Q: Consider the beta oxidation of stearic acid (C18:0): How many ATP are generated in complete…
A: Stearic acid has 18 C so 8 cycles are involved in its beta oxidation, One cycle yield 1 FADH2 and 1…
Q: The "D" in DNA stands for which of the following?
A: DNA : Chemical name for molecule which carries genetic instructions in the living organisms.
Q: Why is it agreeable from a food safety point of view to keep soy sauce in your cupboard and not the…
A: Soy sauce is produced by the fermentation of soyabeans, grains, and brine using molds- Aspergillus…
Q: DNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B |C| D Exons: A, C, D…
A: hnRNA is a heterogenous RNA , also called as pre mRNA formed by the enzyme called RNA pol 2 ,…
Q: how allosteric regulation is fundamentally different from competitive/uncompetitive/mixed inhibition…
A: Some categories of enzymes exhibit kinetic properties that cannot be studied using Michaelis-Menten…
Q: What is tne value of VX P in tne Table 6? Table 6. Data on Volume-Pressure Relationship Trial volume…
A: Answer- The value of V*P is given below- Trial Volume (L) Pressure (atm)…
Q: 9. It is noted recurrent vomiting, weakness, sleepiness, and convulsive attacks, as well, in…
A: The ureotelic organisms are the organisms, which convert the ammonia formed through protein…
Q: From an extract of human cell growing in tissue culture, A fibrous substance was obtained. How would…
A: Introduction: The primary structure of both DNA and RNA are similar. Each consists of a…
Q: do aklaloids minic neutrotransmitters in our bidy? amines contain: a) nitrogen atom b) an acid c)…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: 3- Planning, implementation and evaluation
A: Health Sector is the most important sector of today's world which includes which includes hospitals,…
Q: Indicate what step each of the events in the glycolysis pathway the following takes place: a.…
A: Glycolysis is a metabolism of glucose (six carbon molecule) into three carbon molecule (pyruvate)…
Q: 10. Isoniazid (MAO inhibitor) is prescribed to the patient with Parkinson discase. What does cause…
A: Parkinson's disease is commonly seen in adults after the age of 50. Parkinson's disease is known to…
Q: Proteins called molecular chaperones assist in the process of protein folding. One class of…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: 4. Synthesis of basic corticosteroids. Steroid: A. Testosterone. B. Aldosterone. C. Pregnenolone. D.…
A: Introduction: Corticosteroids are steroid hormones that are synthesized in the adrenal cortex. It is…
Q: 5. Compare and constrast the energy content of fats, carbohydrates and proteins.
A: Carbohydrates, proteins and fats are three major form of biomolecules found in living beings. These…
Q: 3. A 2-year-old child was taken to the hospital. His mother said that he vomited frequently,…
A: The inborn error in metabolism occur due to mutation in a gene of the metabolic pathway.
Q: 6. An organic substance bound to an enzyme and essential for its cavity is called: a. Coenzyme b.…
A: The non-protein factors that are necessary for activity of some enzymes are called cofactors.
Q: Morphine (give structure) and en receptor. How is that possible?
A: Antagonist are the drugs that plays an important role in blocking opiods without activating them by…
Q: 6. When a concentrated alkali solution acts on the purine cycle, it breaks down: A. Ester group B.…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: 1.A:Identify the three major chemical buffers of the body B : Choose one and describe the operation…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…
Q: How many FADH2 and NADH molecules get produced by beta oxidation of palmitic acid (a 16 carbon fatty…
A: Beta oxidation is a process of breakdown of fatty acid molecules by breaking the bond between beta…
Q: How is Pyruvate Kinase Deficiency (PKD) inherited? What gene is responsible for the expression of…
A: Pyruvate kinase is an enzyme that regulates cell metabolism by catalysing the conversion of…
Q: Draw the two amino acids serine and alanine, and a dipeptide that could be formed by combining these…
A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…
Q: Where would the catalase enzyme perform best- in the human blood stream OR in the human stomach?…
A: Catalase is common enzyme found in all aerobics and it convert reactive oxygen species H2O2…
Q: Consider the Michaelis-Menten equation, below: Vmar S V. k + [S] %3D What is the relationship…
A: [S] : Substrate concentration V= Vmax[S]/(Km+[S]) Vmax: Maximum velocity Km: [S] at which V is…
Q: Why are they so designated? Ketone bodies are so named because they contain the ketone functional…
A: Ketone bodies are produced by the liver during caloric restriction.
Q: CH,O-P-o C=O 0. CH,O-P-o- CH-OH C=O Ó. HO-C-H H-C-OH H-C-OH O C-H of ČH;O-P-0- H-C-OH O CH;0-P-O 0.
A: Glycolysis is the metabolic pathway that converts glucose into pyruvic acid.
Q: 5- Draw structure of products in the following metabolic reactions and name the enzyr involved and…
A: Introduction: The drug metabolism is needed to convert non-polar lipophilic compounds into polar…
Q: While fatty acids are most often formed by the condensation of_-carbon units, isoprenoids are…
A: Fatty acid and isoprenoid both are class of lipid and plays an important role in the metabolism of…
Q: Explain the four stages of biochemical energy production from food which are part of the typical…
A: The which we consume is composed of nutrients like carbohydrates, proteins, and lipids. After…
Q: Which among the following The colored solution formed as a positive result for the Biuret test is…
A: A polypeptide chain has amino acids linked together by a peptide backbone.
Q: Which statement is correct about expression of a gene regulated by Gal4? O Galactose increases gene…
A: In yeast the transcriptional activator GAL4 binds to the upstream activating sequence of the gal…
Q: v Vitamin E A. diminished intestinal absorption of lipids v Vitamin K B. night blindness v Vitamin A…
A: Vitamin are organic chemical compounds that are not synthesised by our body. They are required in…
Q: 1. What are the major functions of lipids?
A: Introduction: Lipids are a heterogeneous group of biological compounds which includes fats, oils,…
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- MATCHING TYPE a. Peroxidase b. Thrombin c. Amylase d. Diastase e. Amylopsin f. Invertase or Sucrase g. Zymase h. Emulsin 11. Bring about the oxidation reactions that cause the discoloration of bruised fruit. 12. Converts the fibrinogen of the circulating blood into the insoluble fibrin of the blood clot. 13. Found in the salivary glands. Also known as salivary diastase or ptyalin. 14. A yellowish white, amorphous powder obtained from an infusion of malt. 15.Found in the digestive tract of animals. Sometimes called “animal diastase”. 16.Aids in the hydrolysis of sucrose into glucose and fructose. 17. Fermenting enzyme causing the conversion of monosaccharides (glucose, fructose) into alcohol and CO. Note: No need to explain. Just direct answer.(Biochemistry Topics: Glycolysis and Citric Acid Cycle) Why would a defect in the liver enzyme FBPase-1 result in abnormally high levels of blood lactate? Explain.1. State if true or false a. Gluconeogenesis is the exact opposite of the glycolytic pathway b. The end-product of glycolysis is Acetyl CoA c. There is no enzyme being secreted in the stomach for carbohydrate digestion d.Glycerol 3-phosphate shuttle, which is active in skeletal muscles and in the brain, bypasses Complex I and II of ETC resulting to less energy produced compared to malate-aspartate shuttle. e. Insoluble NSP has high water holding capacity and will increase the intestinal transit time of digesta.
- In angiogenic endothelial cells, pyruvate is converted to lactate (generating 2 ATP per glucose) rather than being completely oxidized (which would generate ~32 ATP by oxidative phosphorylation). Explain why angiogenic cells generate ATP anaerobically.When acetyl-CoA oxidized via the citric acid cycle, yields 10 ATP equivalents: 3 NADH, 1 FADH2, and 1 ATP or GTP. a. False b. TrueTumor cells often lack an extensive capillary network and must function under conditions of limited oxygen supply. Explain why these cancer cells take up far more glucose and may overproduce some glycolytic enzymes.
- Understanding the Mechanism of Hemolytic Anemia Genetic defects in glycolytic enzymes can have serious consequences for humans For example, defects in the gene for pyruvate kinase can result in a condition known as hemolytic anemia. Consult a reference to learn about hemolytic anemia, and discuss why such genetic defects lead to this condition.Give answer of 1,2,3, MCQ's 1. Which of the following statements about delto-ALA (amino amino ievulinate Synthases are FALSE? A It catalyzes the rate limiting step in the pathway of heme synthesis B. It is allosterically activated by heme C. It synthesizes delta-ALA from glycine and acetyl-CoA D. It has a decreased activity in case of vitamin 87 deficiency E. Heme influences the concentration of delta-ALA synthase in the red blood cell precursor. 2. Select the correct statements about heme degradation: A. It involves the removal of Fe2+ from heme molecule with the generation of protoporphyrin B. During heme degradation, the protoporphyrin ring is opened and CO is released C Bilirubin is conjugated with UDP glucuronic in the spleen D. The conjugated bilirubin is transported in plasma by albumin E. The stercobilin that arises by the oxidation of urobilinogen confers the characteristic color of the feces 3. Which of the following represent possible consequences of an intense hemolysis…a. In the TCA cycle, which of the following combines with acetyl CoA to form a 6-carbon compound? i. oxaloacetate ii. thiamine iii. glucose iv. pyruvate b. The last step in glycolysis is the transfer of phosphoryl group from phosphoenolpyruvate to ADP catalyzed by pyruvate kinase. i. True ii. False
- Question:- Explain why it makes sense for the PDH complex in liver to be active when dephosphorylated.1. Briefly explain why an individual with Aldolase B deficiency will suffer from hypoglycemia upon ingestion of fructose. Make sure to mention the affected pathways and explain why these are affected. 2. Briefly explain the mechanism involved when an individual with glucose 6-phosphate dehydrogenase deficiency develops an episode of hemolytic crisis after eating fava beans. Make sure to mention pathways and enzymes involved.Which of the following statements are FALSE? Multiple answers:Multiple answers are accepted for this question Select one or more answers and submit. For keyboard navigation...SHOW MORE a In the TCA Cycle 3 molecules of NADH are produced per molecule of Acetyl-CoA oxidized. b Intracellular concentrations in resting muscle are as follows:Fructose-6-phosphate (1.0 mM)Fructose-(1-6)-bisphosphate (10.0 mM)ADP (0.5 mM)ATP (5.0 mM)Under the above conditions the Phosphofructokinasereaction in muscle is more exergonic than under standard conditions. c The E2 component of the Pyruvate Dehydrogenase complex binds NAD+ in its active site. d If 14CO2 was bubbled through a suspension of liver cells that was undergoing gluconeogenesis from lactate to glucose carbons 1 and 6 of glucose would be radioactive. e When Acetyl-CoA levels exceed the Oxaloacetate supply allosteric activation of Pyruvate Carboxylase results Acetyl-CoA raising the Oxaloacetate levels…