4. Synthesis of basic corticosteroids. Steroid: A. Testosterone. B. Aldosterone. C. Pregnenolone. D. Progesterone. E. Cortisol. HO CH3 1 HO OH Мервы HO 2 buenoca CHOH HO OH 3 epebi Крственный Киверситет
Q: Which of the following is TRUE concerning the induced fit model of enzyme catalysis? * (One correct…
A: Induced fit model: this theory explains that the active site of an enzyme is so flexible that…
Q: Match the following descriptions to the given choices.…
A: A lipid is a biomolecules which include fats, waxes, oils, hormones, and certain components of…
Q: Which reaction in glycolysis produces ATP as a product? Group of answer choices hexokinase…
A: Glycolysis : Process in which the glucose gets broken to produce pyruvate, ATP, NADH and water.
Q: Match lipid descriptions in column A with the phospholipid types in column B. H is attached to the…
A: Phospholipids are found in the membrane. Their structure comprises of polar head group &…
Q: 1) You wish to make a restriction map of a 17.0 kb linear fragment. You digest the fragment with…
A: Restriction map is a map of the restriction sites present in gene/DNA sequence. Restriction enzymes…
Q: Design a concept map on microbial growth that would contain the key features of the following…
A: Controlling microbial growth is essential in many practical situations, and research in this area of…
Q: The steps of glycolysis between glyceraldehyde 3-phosphate and 3-phosphoglycerate do NOT involve:…
A: Glycolysis is defined as the process of breaking down the compound called "glucose" to create…
Q: Progesterone is mainly responsible for the development of sexual characteristics and function O True…
A: Progesterone is a C-21 steroid hormone. Cholesterol is the precursor for progesterone. Progesterone…
Q: With Fehling's reagent (under certain conditions) interact: A. Glucose B. Quinine hydrochloride C.…
A: Fehling's reagent is a reagent commonly employed in differentiation of water soluble carbohydrates…
Q: S. Why are histamine and serotonin contents increased in the site ol inilammatory? Explain the…
A: Histamine is an organic nitrogenous compound which is synthesized from amino acid residue…
Q: You receive a tube containing 18.8 nmol of lyophilized (freeze dried) primers to be used in PCR. How…
A: Primers are a short nucleic acid sequence that provides a starting point for DNA synthesis. I…
Q: 3. sports amp. Intensively pool for 120 minutes two hours after each meal. What metabolic changes of…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…
Q: I want a solution that is 1/10th the strength of my stock solution. I want 20 microliters of total…
A: A solution can be diluted to the desired concentration by using the formula C1V1=C2V2 Where C1=…
Q: A recent genome sequencing project for the bacterium Burkholderia mallei has identified a new…
A: The new protein identified here has a partial sequence given as TVEVNAPGDVQKALSELQQINDGRLDIRI…
Q: Question 24 CH,-0-C-(CH,)14–CH, CH-0-C-(CH,)16-CH, CH3 сH, —о—р—о—сH, — сн, — N—сH, CH, What is the…
A: Depending on the strut of lipid ,they are classified as simple and complex lipid. Simple lipids are…
Q: In Table 13-1, what is the most common function of proteins that contribute to pattern formation?…
A: Drosophila melanogaster, a fruit fly, is utilised as a model organism in research spanning from…
Q: Which statement does NOT describe a general function of the pentose phosphate pathway? Group of…
A: The pentose phosphate (hexose monophosphate shunt) process is more complicated than glycolysis.…
Q: Think about ONE possible consequence with a brief explanation if the primers were not removed after…
A: Introduction: DNA is a genetic material that defines every cell. Before a cell duplicates and is…
Q: 2. ( To the right is a schematic diagram of His the active site in the Michaelis complex of a-chy-…
A: Chymotrypsin is a protease that cleaves a peptide at the C-terminal of all aromatic amino acid.…
Q: ceramide with a single sugar is called? Cerebroside Plasmalogen Sphingomyelin…
A: sphingolipids : found in brain extract, contain a backbone of sphingoid bases, a set of organic…
Q: blocking the oxidation/reduction reaction can be led to: Select one: O a. produce water Ob. death…
A: Metabolism is a series of interconnected chemical reactions occurring within a cell; the chemical…
Q: 3. Based on the name of the following hypothetical drug salts, which of the following statements is…
A: The given options of hypothetical drug can be described as below in terms of acid and base:…
Q: Please discuss any two of the structures and functions of these 4 molecules. What do they have in…
A: 1. Main carbohydrate storage in plants. 2. Monomer - Alpha glucose 3. 1,4 -glycosidic bond in…
Q: 18:1c∆9 ω-9 fatty acid oleic acid both are correct neither is correct
A: In plants, animals, and microbes, fatty acid is a key component of lipids (fat-soluble components of…
Q: How does the presence or absence of oxygen influence cell
A: Metabolism is the process of extracting cellular energy from the sources like carbohydrate, amino…
Q: Which of the following is a property of an enzyme? * (Please choose one correct answer only)…
A: Enzymes are the biological catalysts that mediate biochemical reactions by decreasing their…
Q: List and describe the major tissues involved in cholesterol metabolism and their core enzymes.
A: In addition to serving in the manufacture of steroid hormones, vitamin D, and bile acids,…
Q: Identify the 4 steps of gluconeoegenesis that are different from glycoslysis. Write the reactants,…
A: Gluconeogenesis (GNG) is a metabolic pathway that results in the generation of glucose from certain…
Q: When the blood glucose is low, insulin is released from the pancreas to maintain glucose…
A: Insulin is a polypeptide hormone produced by the beta-cells of the islets of Langerhans (of…
Q: i need the answer quickly
A: Vitamin B6 aids in the maintenance of a healthy level of this amino acid in the blood. A more…
Q: Match lipid structures in column A with its lipid type in column B
A: Lipids are the group of organic components having oily or greasy consistency. Lipids are a group of…
Q: Choose the wrong statement: Select one: O a. Energy can be converted from one form to another. O b.…
A: ATP (adenosine triphosphate) is a molecule that provides energy to drive many processes in the cell,…
Q: Three [BIOMOLECULES] Instructions; — Answer the questions properly. — Do not copy in Google or…
A: Fatty acids are hydrocarbon chains with a carboxylic acid group. Fatty acids are classified as…
Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA
Q: How many molecules of NADH are produced if 12 molecules of glucose enter the glycolytic pathway?
A: Glycolysis is a catabolic process which occurs in cytosol.
Q: How are water-soluble vitamins different from fat-soluble? * (Please choose one correct answer only)…
A: Vitamins are essential nutrients required for the body to fight against diseases. There are two…
Q: Question 23 18:1cA9 O w-9 fatty acid O oleic acid
A: Polyunsaturated fats, such as omega-3 fatty acids, are a form of fat that body cannot produce.…
Q: 4. Liver alcohol dehydrogenase (LADH) catalyzes a reversible, pH-dependent oxidation of an alcohol…
A: Density=massvolumeDensity of methanol=mass of methanolvolume of methanol0.79 g/ml=mass of…
Q: Given Ribose, Briefly explain its expected reaction (based on their structural formula) to the…
A: Ribose is a simple sugar and carbohydrate. Ribose, also called D-ribose is a five-carbon sugar found…
Q: Only one of the statements below is correct; which one? Two solutions are hypotonic when they have…
A: The terms isotonic, hypertonic, and hypotonic are typically used to compare the concentration of a…
Q: How can human females and males function normally, despite carrying different umbers of the X…
A: Each persons normally has one pair of sex chromosomes in each cell. Females express two X chrmosome…
Q: 2. In volunteer group starving more than 2 days, blood glucosc concentration reduced till 60 mg/dl.…
A: Glucose is the primary source of energy for the body. When there is no dietary supply of glucose,…
Q: Given Tagatose, Briefly explain its expected reaction (based on their structural formula) to the…
A: The Molisch's test, Fehling's test, and Bial's test are the qualitative tests for carbohydrates. In…
Q: Retroviruses, like the HIV, contain an enzyme called reverse transcriptase. Explain the flow of…
A: Introduction: In retrovirus, RNA is used as genetic material. It uses the enzyme…
Q: Match the each enzyme deficiency with their corresponding disease…
A: Different enzymes are required for synthesis of spingolipids. If these enzymes are not…
Q: How histone and micro RNA controls gene expressi
A: Histones are positively charged basic proteins that associate with DNA in the nucleus and forms…
Q: In a 25 uL reaction, you desire a buffer concentration of 1X. You will be supplied with a stock…
A: Dilution of buffer solution or any solution can be done to obtain a diluted solution with varied…
Q: Question 4 Match the following descriptions to the given choices v Synthesized from a steroid…
A: Vitamins are essential nutrients that are important for the protection of body from diseases.…
Q: Which statement is correct about expression of a gene regulated by Gal4? O Galactose increases gene…
A: In yeast the transcriptional activator GAL4 binds to the upstream activating sequence of the gal…
Q: 1. What are processed foods?
A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…
![4. Synthesis of basic corticosteroids. Steroid:
A. Testosterone.
B. Aldosterone.
C. Pregnenolone.
D. Progesterone.
E. Cortisol.
но
CH3
OH
но
ковский
uneuy
ченова
но
CHOH
HO
OH
3
HO
HO
Tepebi
Крственный
AuGepcumem](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F28d3be68-79fc-4d2a-8bf6-479ce02507a6%2F82e110f4-e7e1-4a2f-946c-b67570bcb4b0%2Fcwoj2wy_processed.jpeg&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- 37. Which is not TRUE in the following statements? * a. Hormones affect various processes in the body as they regulate and balance the functioning of organs, tissues, and cells. b. Hormones greatly influence growth, appearance, emotions, and reproductive functions. c. Hormones play an essential role in the occurrence of disorders such as diabetes, thyroid disease, growth and/or sexual dysfunction. O d. Too much secretion of hormones does not affect homeostasis. 39. Which of the following statements best explains the Theory of Natural Selection? * a. Organs that are not used may disappear while organs that are constantly used may develop. b. In nature, the organisms with desirable characteristics may survive while those with weaker traits may not. O c. Organisms develop desirable structures to survive in a given environment. d. Acquired characteristics of parents can be passed on to offsprings. оо O O1.Hormone secretion is... (Choose more than 1 answer) A. As fast a neural electrical signals B. Last longer than neural electrical signals C. Are slower than neural electrical signals D. Don't last as long as electrical signals. 2.Which struture functions only for the endocrine system? A. pituitary B. thymus C. hypothalamus D. pancreas 3.Which of the following symptons do not describe hyperthyroidism? A. anxiety B. insomnia C. weight gain D. heat intoleranceWhich of these is not a means by which hormones are eliminatedfrom the circulatory system?a. excreted into urine or bileb. bound to binding proteinsc. enzymatically degraded in the blood (metabolism)d. actively transported into cellse. conjugated with sulfate or glucuronic acid
- Which of the following class of chemicals exerts its effects by entering cells, binding intracellular receptors, and affecting gene expression? a. Peptides b. Steroids c. Bioactive amines d. Amino acids Studies have demonstrated biological differences between adult heterosexual and adult homosexual men. Which of the following has been shown to be different between these groups? a. different pattern of cortical neuron branching b. different testosterone levels c. different size of a hypothalamic nucleus d. different estrogen levels1. Some Hormones are derived from tyrosine, example --------------------. A. ADH B. steroids C. Insulin D. Melatonin E. All of the above 2. The hypothalamus controls the secretion of the adenohypophysis by ----------- A. Secretion of releasing and inhibiting factors into a tiny portal system. B. Indirect osmotic control. C. Direct neural stimulation. D. Gap synaptic junctions. E. Altering ion concentrations and pH in the anterior pituitary. 3. All of the followings are correct about Atrial natriuretic factor, except ------------------. A. It is secreted by stretch receptors in the atria B. It inhibits ADH secretion C. It increases urine volume D. It reduces blood pressure E. It decreases GFR 4. Hypothalamus releases ________________ hormone, which stimulate the Pituitary gland to release ____________ hormone. This will stimulate thyroid gland to release its__________. A. Thyrotrophic releasing hormone, Thyroid-stimulating hormone, Thyroid hormones B. Adrenocorticotropic, Corticotropin…17. Steroid hormones are... a. polar hormones exert their effects via a second messenger system b. polar hormones exert their effects via an intracellular receptor C. nonpolar hormones exert their effects via an extracellular membrane receptor dnonpolar hormones exert their effects via a cytoplasmic or nuclear receptor e. nonexistent in the body
- Not a side effect of Ephidrine a. Seizures. b. Stroke. c. Increase in psychiactric symptoms. d. Hypogonadism.10. Previous pituitary hormones travel to which structure(s)? to. Thyroid b. Adrenal medulla C. Testes d. A and C only e. All of the above 11. Which hormone is released from the hypothalamus when body temperature is too low? Corticotropic Releasing Hormone (CRH) b. Gonadotropic Releasing Hormone (GNRH) c. Thyrotropic Releasing Hormone (TRH) d. Growth Hormone Releasing Hormone (GHRH) e. Follicle stimulating hormone (FSH)||33. Choose the hormone that is NOT correctly matched with the endocrine gland that secretes it. A. adrenal cortex-aldosterone B. thyroid gland-oxytocin C. pancreas-insulin D. pineal gland-melatonin 34.If blood transports hormones throughout the body, how do they communicate with specific targets? A. Special gateway valves in the blood vessels direct hormones to their target tissues. B. Special carrier proteins "walk" along microtubule tracts to deliver the hormones to their targets. C. Axonal pathfinding mediates the delivery of hormones to their specific targets. D. Only target tissues have receptors that allow them to receive the signal. 35. The cell-mediated immune response is brought about by which cells? A. B cells B. T cells C. erythrocytes D. fibroblasts 36. What is the source of antibody-producing cells? A. B cells B. macrophages C. T cells D. monocytes 37.Before cell division of somatic cells, each chromosome must be replicated. After replication, the resulting two parts of…
- Activity of alpha-glucosidase inhibitors is decreased by all of the following medications, except:A. Enzymes B. Adrenergic blockersC. Oral contraceptive agentsD. Thiazide diureticsE. Isoniazidwhich of the following happens when a therapeutic synthetic homone is introduced intno the body to treat patients natural hormone insufficiency?(select all that apply) A. The target cell responds the same way as when the hormone is natural B. the synthetic hormone has no effect on the target tissues C. the amount of natural hormone produced by the patients body declines D. the synthetic hormone is destroyed before it can have an effect on the target tissue.Which of the following hormones does the skin produce? a.renin b.melatonin c.cholecalciferol dervthopein granulocytes do not include a.pmns brmonocytes G.basophils mature red blood cells in the circulating blood are filled with a.lysosomes b.smoooth endoplasmic reticulum c.nuclei a healthy adult male has approximately liters of blood а, 1-2 b.2-3 c.3-4 most numerous leukocyte a.neutrophil b.monocytes which leukocyte contains histamine in its granules a.basophil b.neutrophil chief end product of urine metabolism a.urea b.uric acid
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781319114671/9781319114671_smallCoverImage.jpg)
![Lehninger Principles of Biochemistry](https://www.bartleby.com/isbn_cover_images/9781464126116/9781464126116_smallCoverImage.gif)
![Fundamentals of Biochemistry: Life at the Molecul…](https://www.bartleby.com/isbn_cover_images/9781118918401/9781118918401_smallCoverImage.gif)
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305961135/9781305961135_smallCoverImage.gif)
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
![Fundamentals of General, Organic, and Biological …](https://www.bartleby.com/isbn_cover_images/9780134015187/9780134015187_smallCoverImage.gif)
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781319114671/9781319114671_smallCoverImage.jpg)
![Lehninger Principles of Biochemistry](https://www.bartleby.com/isbn_cover_images/9781464126116/9781464126116_smallCoverImage.gif)
![Fundamentals of Biochemistry: Life at the Molecul…](https://www.bartleby.com/isbn_cover_images/9781118918401/9781118918401_smallCoverImage.gif)
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305961135/9781305961135_smallCoverImage.gif)
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
![Fundamentals of General, Organic, and Biological …](https://www.bartleby.com/isbn_cover_images/9780134015187/9780134015187_smallCoverImage.gif)