Q: UAA is a stop codon. Why does the UAA sequence in the segment of mRNA…
A: Stop codons do not specify any amino acid. When ribosome faces any stop codon, it stalls. When the…
Q: What amino acid is coded for by each codon? a. GCC b. AAU c. CUA d. AGC e. CAA f. AAA
A: GCC -Alanine AAU - Asparagine CUA - Leucine AGC- Serine CAA - Glutamine AAA - Lysine
Q: If a tRNA has an anticodon sequence 3′–CCI–5′, what codon(s) can it recognize?
A: Ribonucleic acid (RNA) is a polymeric molecule essential in various biological roles. It includes…
Q: TRACE THE CODE| Order of bases in MRNA (codon) AUC Order of bases in ERNA (anticodon) Order of bases…
A: Complete this table of codes.
Q: Translation begins with the_______ codon of mRNAand continues until a(n)_______ codon is reached.…
A: For the expression of a gene, the sequence present in a DNA molecule must be converted into a RNA…
Q: If the DNA sequence is ATG-CGT, the mRNA codons are ___. ATG-CGT UAC-GCA GUA-CGU AUG-CGU…
A: DNA full form is deoxyribonucleic acid. DNA is the main constituent of the chromosome. It contains…
Q: Which amino acid sequence will be generated during translation from the following small mRNA:…
A: According to the hint given then the start codon is AUG (Met) The stop codon is UGA .
Q: The mRNA sequence AUG CAC AGU codes for the first three amino acids of a particular protein. Which…
A: The mRNA synthesized after transcription process undergoes translation to synthesize proteins. The…
Q: If an mRNA codon reads UAC, its complementary anticodon will bea. TUC.b. ATG.c. AUG.d. CAG
A: During translation the ribosome traverses over the mRNA in order to produce a peptide chain with the…
Q: During translation, a peptide is PRODUCED , while the MRNA is READ N-->C, 3-->5' 5'-->3'; N-->C.…
A: ANSWER;- N'-- C; 5'--3';
Q: When a ribosome reads a codon onmRNA, it must bind to the ____________of acorresponding tRNA.a.…
A: Protein synthesis involves two processes known as transcription and translation. In transcription,…
Q: The dna is CAT CCA ACC ATA CCC CTA TAC CCA TAT CCT CCC ATT AAA CCG what is the mRNA and A.A.?
A: Thank you for the question Answer :- The process of conversion of DNA to mRNA is called as…
Q: If the sequence of DNA on the template strand of a gene is AAA,the mRNA codon produced by…
A: Transcription is the process of formation of RNA using the DNA template strand. Both strands of a…
Q: If the sequence of the coding strand in a transcription unit is written as follows: 5'-…
A: In that question we have to write down the sequence of mRNA.
Q: The codon is found on mRNA? True or False?
A: Codon is a sequence of three consecutive nucleotides in DNA or RNA, that codes for a specific amino…
Q: A ribosome binds to the following mRNA at the site indicatedby the dark box. At which codon will…
A: The mRNA strands obtained after the transcription of the antisense DNA strand (also known as the…
Q: Match each function to the appropriate type of RNA. Messenger RNA (MRNA) Ribosomal RNA (1RNA)…
A: Introduction :- Transcription is the process of synthesis of different types of RNA molecules from…
Q: When MRNAS are edited to become mature mRNA, the nonsense regions that are removed are called and…
A: Ribonucleic acid (RNA) is a significant organic macromolecule that is available in all natural…
Q: Which amino acid is coded by the "stop" codons? O a. Pro
A: Codons are trinucleotide sequences. They can belong to RNA or DNA. They mainly correspond to the…
Q: Which of the following codons is called the start codon?
A: AUG is the Start codon, which codes for Methionine.
Q: Which sequences are spliced out of the mRNA strand before leaving the nucleus? In other words,…
A: Answer: TRANSCRIPTION : It is the process in central dogma where a DNA strand is transcribed in to…
Q: The first codon in a mRNA will be ____ and will code for ___ and the final codon will be ______ and…
A: To synthesize protein molecules, a cell must first transfer information from DNA to mRNA through the…
Q: Which one of the following sequences is most likely to cause a ribosome to release a mRNA strand?…
A: A ribosome is an inter - cellular structure made up of both RNA and protein that provides as the…
Q: AG Codons: a. MRNA 5'1 3' Amino acids: с. d.
A: Transcription is the process by which RNA synthesized with the help of the DNA and translation is a…
Q: In transcription, the nucleotide sequence CAATGGC in DNA would code for [1] in mRNA. O GTTACCG O…
A: The genes are the segments of DNA which carries information for the synthesis of the functional…
Q: Translate the following mRNA into protein, starting from the first initiation codon:…
A: Translation is the process of synthesis of protein from an mRNA. mRNA synthesized through…
Q: What will be the next amino acid added to the growing polypeptide chain?
A: mRNA contains codons and tRNA contains anticodon. Codons and anticodons are complementary to each…
Q: If the DNA triplet is TTA, then the transcribed MRNA codon would be
A: All living organisms store their genetic information in form of DNA / RNA. This genetic information…
Q: An anti-codon is on what kind of molecule? O DNA O TRNA O polypeptide O MRNA
A: An anticodon is a tri-nucleotide sequence which is complementary to the codon sequence present on…
Q: What polypeptide is coded for by this mRNA sequence? 5'-GCU-GAA-GUC-GAG-GUG-UGG-3'
A: Codons are trinucleotide sequence (DNA, RNA) that codes for specific amino acid and chain of amino…
Q: During the initiation of translation, the ribosome assembles on an mRNA strand with the start codon…
A: The process of polymerisation of amino acids from a polypeptide is known as translation. The…
Q: Write the standard base sequence of the messenger RNA that would cause a ribosome to make the…
A: The amino acids in the protein are placed in the order from N-terminus to C- terminus. The mRNA are…
Q: DNA Sequence mRNA Sequence (codon) tRNA Sequence {anticodon) AMINO ACID Sequence
A: Introduction DNA (Deoxyribonucleic acid)serves as the genetic material of almost all organisms (some…
Q: In the normal course of events within protein synthesis, which of the following is part of, or cal…
A: The tRNA molecule has a distinctive folded structure with three hairpin loops that form the shape of…
Q: The “start” codon is ____ - ____ - ______
A:
Q: Which three codons would code for a different amino acid sequence from that coded for by the mRNA…
A: Given: mRNA base sequence: AGU-UCA-CCA Have to determine which three codons will code for a…
Q: Using the following DNA template code, which of the following tRNA anticodons would carry the 4th…
A: Introduction DNA:- (Deoxyribonucleic acid) It is a long molecule that contains our unique genetic…
Q: A mutation that changes a normal codon to a stop codon is called a
A: The mutation is a permanent alteration in the DNA sequence that makes up a gene, such that the…
Q: Construct a polypeptide chain by translating the given red strand of the mRNA segment.…
A: Translation It is defined as the process of protein synthesis in which the sequence of mRNA is…
Q: If the codon for Histidine is 5' CAU 3' in an MRNA molecule, the anticodon on the TRNA is: UAC ATG…
A: In every group of messenger ribonucleic acid (mRNA), there are three bases. A codon is also there…
Q: Which of the following codons in an MRNA can be recognized by the tRNA with UAA anticodon sequence…
A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…
Q: What amino acid sequence will be generated, based on the following MRNA codon sequence? 5' AUG- UCU-…
A: The genetic code is the precise sequence of DNA nucleotides interpreted as three-letter words or…
Q: One gene (segment of DNA) codes for one ______ One mRNA codon codes for one _______
A: One gene (segment of DNA) codes for one ______polypeptide chain. ____ Note: Gene is the small…
Q: When a triplet of bases in the coding sequence of DNA is “GCA,” the corresponding codon for the mRNA…
A: there are two types purines and pyramidines. A=T G=C In case of mRNA A=U Thymine is replaced by…
Q: if mRNA has a codon sequence of 5'-UAG-3', it will encode: Ieucine, no amino acide, methionine, a…
A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum create…
Q: When the anticodon on a tRNA is "ICG, all of the following codons except can pair with this…
A: Some tRNA anticodon loops contain inosine (I) which allows recognition of multiple codons through…
Q: Determine the mRNA sequence for the wild type polypeptide by identifying the codons that correspond…
A: Polypeptides are chain of amino acids which is bonded by the peptide bonds. It is coded from the…
Q: Anticodons pair with ___ .a. mRNA codonsb. DNA codonsc. RNA anticodonsd. amino acids
A: It is a process from central dogma where protein synthesis takes place with the help of ribosomes,…
Q: Given the mRNA for a protein: 5'–CCGAACGAUGGGCUAUCCCUAACCGUUU --- 3' Write the amino acid sequence…
A: DNA is the genetic material that gets transcribed into mRNA by an RNA polymerase enzyme. The…
Q: If the following were part of a DNA chain, what mRNA bases would pair with it to transcribe the DNA…
A: INTRODUCTION The carrier of genetic information within a cell is DNA, which stands for…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
An amino acid sequence reads:
N—Met-Gln-Leu-Arg-Cys—C
Write out one possible mRNA sequences with a stop codon.
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- The codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine, and cytosine- adenine-guanine (CAG) codes for glutamine in humans. RNA Codon Chart UCAGUGA Alanine Tyrosine Stop Cystoine Stop Valine G U A GTryptophan Arginine A Leucine Serine Lysine Proline Asparagine ACU lGACU Select the two amino acids that those two codons code for in carrots. O glutamine O isoleucine methionine serine O valine oupne Glycine Phenyl- acid Asparti oartic acid Histidine Glutamine Arginine uauonejos Methionine ThreoninemRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
- If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letterSuppose that a protein has the amino acid sequence Met‑Tyr‑Asn‑Val‑Arg‑Val‑Tyr‑Lys‑Ala‑Lys‑Trp‑Leu‑Ile‑His‑Thr‑Pro A researcher plans to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Her probes should be exactly 18 nucleotides in length. Consult the codon table. Select which amino acids in the protein should be used to minimize degeneracy when designing the probes. Val‑Tyr‑Lys‑Ala‑Lys‑Trp Met‑Tyr‑Asn‑Val‑Arg‑Val Arg‑Val‑Tyr‑Lys‑Ala‑Ly Trp‑Leu‑Ile‑His‑Thr‑Pro Calculate the number of different probes that must be synthesized in order to determine the exact cDNA sequence that specifies the region of the protein selected. number of probes:Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letter
- he sequence is read from left to right. The table below shows which mRNA codons code for each type of amino acid. UUA - Leu | UCA - Ser UAA - Stop | UGA-Stop UUU - Phe | UCU - Ser UAU- Tyr UGU- Cys CỦA - Leu CCA - Pro CAA - Gln | CGA - ArgA UUG - Leu UCG - Ser| UAG-Stop UGG- TrpG A DNA sequence before and after replication IS SHO Second mRNA base G DNA sequence before replication: UUC - Phe UCC -Ser UAC U TACCTAGCT Туг UGC Cys DNA sequence after replication: A TACCTCGCT Leu CCU - Pro CAU - His CGU. CUU Arg U - Pro CAC - His CGC- ArgC CUC - Leu ССС Pro CAG - Gln | CGG - Arg G CUG - Leu CCG Thr AAU - Asn AGU - Ser Ile ACC - Thr AAC- Asn AGC Ile ACU AUU AUC Ser Lys AGA Arg Thr AAG - Lys AGG - AUA Ile ACA - Thr AAA- A mutation occurred in the DNA sequence during replication. Which of the following, A-D, Arg Asp GGU-Gly AUG - Met ACG GUU - Val GCU - Ala GAU - GỤC - Val GCC - Ala GAC - Asp GGC - Gly Val GCA -Ala GAA - Glu GGA - Gly Val GCG - Ala GAG-Glu GGG-Glv describes the result of the…The genetic disorder sickle-cell anemia occurs when the amino acid valine takes the place of glutamate during translation of a hemoglobin chain. Using the table of codons below, determine the mutation in DNA that produces this disorder. 1st position ✓ U C A G Select one: U C serine phenylalanine phenylalanine serine leucine serine leucine serine leucine leucine leucine leucine isoleucine isoleucine isoleucine methionine Table of mRNA Codons 2nd position valine valine valine valine proline proline proline proline alanine alaninc alanine alanine A tyrosine tyrosine a. CUC changes to C AG b. GAA changes to GUU c. CTT changes to CAT d. C A G changes to CTC stop stop threonine asparagine threonine asparagine threonine threonine histidine histidine arginine arginine glutamine arginine glutamine arginine lysine lysine G cysteine cysteine stop tryptophan aspartate aspartate glutamate glutamate serine serine arginine arginine glycine glycine glycine glycine 3rd position DCMO U С A G U C A G…What amino acid sequence is encoded by the codon sequence ACGCAGCGCCCGGUC? Use the 3 letter abbreviation with hyphens and no spaces in between.
- Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCTUsing the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the polypeptide chain based from the given codons of MRNA (3' AAU GCC AGU GGU 5')? * U UUU Phe UCU) UC UCA UCG UAU] UAC Tyr UAA Stop UGA Stop A UAG Stop UGG Trp G UGU U UUC) UGC Cys Ser UUA Leu UUGJ CU) CCU CAU1 CGU His CUC CAC CAA CGC CC Leu CCA Pro Arg CUA CGA A Gin CUG) CG CAG CGG G AUU) ACU) AGU AAU1 Asn AAC, Thr AAA1 U AGC }Ser č A G AUC lle ACC A AUA J ACA AGA AUG Met ACG, AAG}Lys AGG Arg GGU GUU) GUC Val GCU) GCC GCA GCG J GAU1 Asp GACI Ala GGC GGA GGG ) G GUA Gly GAA1 GAG) A Glu GUG) G Figure 1.3 Alanine, Serine, Glycine, Asparagine Serine, Glycine, Asparagine, Alanine Glycine, Asparagine, Alanine, Serine Asparagine, Alanine, Serine, GlycineOn the space provided, type the translation product of wild-type gene A (use three- letter abbreviation for the amino acids; use - to indicate a peptide bond). 5' CTAATCGCCTAATCCGCTTGCGGCCAT 3'