Write the standard base sequence of the messenger RNA that would cause a ribosome to make the following peptide: Met-Val-Asn-Tyr-Tyr
Q: Severe alcohol intoxication can lead to deficiency of vitamin Select one: O a. B1;…
A: Alcohol intoxication is a condition which results from consumption of large amount of alcohols in a…
Q: Substituting antisense oligonucleotide non-bridging oxygen atoms with a sulpha atom: Select
A: Ans. 1. Option d is correct The antisense nucleotide non bridging oxygen atom replace by the sulphur…
Q: Define Lacto-ovo vegetarian. Polysaccharides. Tee Eer Osteopenia Osteomalacia.…
A: Introduction: A healthy diet should contain three important components which are: carbohydrates…
Q: Write down the amino acid sequence of the tripeptide shown below. CH3 H H₂N NH -NH,
A: The above given figure is of a tripeptide. Since we know that an amino acid sequence begins with…
Q: A 0.5µM solution of the protein in 75mL is what you want. In micrograms, how much of the protein do…
A: Molar concentration is a measure of the concentration of a solute in solution with respect to the…
Q: Answer and draw what is given in the question NEATLY
A: The thermophilic bacteria live at high temperatures like hot springs and hot vents. The Arctic Ocean…
Q: describe the various stages that are involved in plant regenerative techniques associated with the…
A: Plant regeneration is the technique by which plant cells, tissues, organs etc. can be cultured…
Q: Which of the following is incorrect about the peptide Val-Leu-Ala-Ser-Gly? It has a net charge of…
A: H3+N-Val-Leu-Ala-Ser-Gly-COO- a) We have 1 positive charge at the N-terminal and one negative charge…
Q: The picture below is of an amino acid called lysine: H₂N. NH₂ OH Download During a period of…
A: Glucose molecules are metabolized through the glycolytic pathway to derive energy in the form of ATP…
Q: What metabolic substrate is produced from the carbon atoms of each of the following amino…
A: Amino acids are organic molecules which act as the building blocks of proteins. During the…
Q: Assume that the gene for pyruvate dehydrogenase kinase is mutated and the mutated enzyme remain…
A: There are several metabolic processes that occur inside an organism to carry out several important…
Q: How to calculate the Km based on this data?
A: hghfjThe tricarboxylic acid (TCA) cycle, also known as the Krebs or citric acid cycle, is the main…
Q: Calculate Kd for the binding of each ligand to this protein. Which ligand binds with greatest…
A: The affinity between the protein and ligand can be studied by association and dissociation kinetics.…
Q: Conjugated proteins which are a combination of amino acids and carbohydrates O A. nucleoproteins OB.…
A: Based on the composition, proteins are of two types, simple and conjugated proteins. The simple…
Q: Which forward are reverse primers will amplify the following sequence by PCR?…
A: As given in the question, forward and reverse primer sequences are to be identified to amplify the…
Q: The structure of the heme prosthetic group is shown. This group is plugged into the protein moiety…
A: Prosthetic groups are non amino acid components that are covalently linked to the protein. Heme…
Q: Given the active site diagram below, which of the indicated components is/are necessary for proton…
A:
Q: The hydrolysis of ATP has a large negative ΔG'°; nevertheless it is stable in solution due to: a.…
A: ∆G (free energy change) is the difference in free energy between reactants and products. The value…
Q: Which of the following regarding disulfide bonds is/are true? Disulfide bonds are the most common…
A: Proteins are composed of amino acids. They are linked together by peptide linkages. Proteins have…
Q: The diagrams illustrate that the membrane selects according to the Initial Two hours later glucose…
A: All the cells prokaryotic as well as eukaryotic are enclosed by a cell membrane. Selectively…
Q: Assume that glycolysis is completely inhibited and thus glucose cannot be converted to pyruvate.…
A: All these reactions of carbohydrate oxidation take place in the liver. Glycolysis occurs in cytosol…
Q: 1. In Gel filtration chromatography, when will you stop collecting eluents if sample is not colored?…
A: As you have posted more than one question, we will solve first question for you. I request you to…
Q: at is nitrogen fixation
A: Answer for the following question is :
Q: INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS…
A: The genetic instructions that are included in a cell's genes can only be read out, or expressed,…
Q: Which of the following is incorrect when comparing myoglobin and hemoglobin? a. Myoglobin and…
A: Hemoglobin and myoglobin are both oxygen-binding proteins. Hemoglobin transports oxygen from the…
Q: Sphingolipids are found in relative abundance in Bacteria Plant cells Nerve cells Intestinal cells
A: Introduction: Sphingolipids consist of a wide range of complex lipids that contain sphingosine…
Q: describe strategies to modify and improve a protein
A: Protein engineering is a new field of science which focuses on improving the functionality of an…
Q: describe 3 applications of cell culture in biomedical research
A: Cell culture is the growth of cells of microorganisms, humans, and plants in the laboratory under in…
Q: Consider the metabolic pathway show below that converts substrate A to B with the enzyme A-ase, B to…
A: Mechanism of Regulation of enzymes is tej process by which enzyme is controlled to catalyse the…
Q: Part 4 7. What was the optimal pH for amylase? Explain how your iodine test results support your…
A: In the given experiment we are using iodine test to test the enzyme activity of amylase. Amylase is…
Q: he following strain of cells lack one enzyme in metabolic pathway. Which of the following strain can…
A: The metabolism of glucose begins with catabolic pathway called glycolysis.where 6 carbon sugars are…
Q: Which are the energy investment steps in glycolysis that transfer phosphate from ATP to a substrate
A: Glycolysis is the process of breakdown of glucose to produce energy in which glucose, a six-carbon…
Q: Malonyl-CoA synthesized by the action of acetyl-CoA carboxylase II is primarily used: a. To…
A: Acetyl CoA is produced in mitochondria and cannot leave mitochondria so it combines with…
Q: What do you think is the most important in biomolecules? Explain
A: Biomolecule are organic molecules present in living organisms. Biomolecules are classified as macro…
Q: The proton pump in ETC is an active transporter. Where does it get the energy to pump protons…
A: ETC is electron transport chain. It is located in inner membrane of mitochondria. It is involved in…
Q: Phospholipases act on which type of lipid? A. glycolipids B. triacylglycerols C.…
A: Lipids are complex fatty acids which are digested by enzymes.
Q: Carbon chains are principal features for both carbohydrates and lipids. What is the primary…
A: Introduction: Carbohydrates are large complex biomolecules that are aldehydes or ketone compounds…
Q: 2 ways that kinases can become resistant to kinase inhibitors? in trace of polyethylene melting it…
A: Kinases are enzymes that catalyze the transfer of gamma phosphate group from ATP to the serine,…
Q: Integral proteins associate with the membrane through A. covalent attachment to lipids. B. covalent…
A: Cell membrane or plasma membrane is a dynamic, fluid structure which acts as a shield and channel…
Q: Which method in biotechnology is used to read and understand an organism's DNA?
A: DNA is a nucleic acid that acts as the genetic material. Knowledge of sequence of an organism's DNA…
Q: ZI A IZ НО. B OH IZ N H НО, E ZI .N.
A:
Q: An enzyme catalyzes a reaction at a velocity of 20 micromole/min when the concentration of substrate…
A: The name of this metabolic pathway is derived from the citric acid (a tricarboxylic acid, often…
Q: 17 What locks all transmembrane proteins in the bilayer? a) Chemical bonds that form between the…
A: Introduction: Membrane proteins are protein molecules that are attached to or linked with the…
Q: Under anaerobic conditions, pyruvate will be converted to lactic acid. Why does this occur? To…
A: Anaerobic Glycolysis is the catabolic process during which Glucose is broken down into lactic acid…
Q: Given the active site below, which best describes the mechanism(s) of catalysis?
A: Active site of the enzyme is the region present on the enzyme where enzymatic catalysis occurs and…
Q: The shortest α helix segment in a protein that will span a membrane bilayer has about _____ amino…
A: The plasma membrane is a bilayer of lipids, in which proteins are floating like icebergs in a sea.…
Q: This test gives yellow solution, indicating the presence of proline* A. Biuret B. Ninhydrin C.…
A: Different of the tests mentioned here are tests for detection of amino acids. In the next step we…
Q: he Michaelis-Menten rate equation for reversible mixed inhibition is written as Vo max [S] akm + a'…
A: Michaelis-Menten equation represents enzyme-catalyzed reactions with a single substrate. Based on…
Q: 2. Suppose you had allowed your dialysis experiment to continue for several days (with the beaker…
A: As given in the question, the dialysis experiment was continued for days with the beaker covered,…
Q: A given enzyme is able to utilize five different substrates. The Km's have measured for each…
A: As you have posted more than one question we will solve the first question for you as per the…
Write the standard base sequence of the messenger RNA that would cause a ribosome to make the following peptide: Met-Val-Asn-Tyr-Tyr
![](/static/compass_v2/shared-icons/check-mark.png)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-For the following DNA bases, give the complementary mRNA code that would be transcribed from these bases: AGCTAATCGGCTACCAGGTACGGATATTCCThe peptide hormone oxytocin induces labor by stimulating the concentration of uterine smooth muscle. Its amino acid sequence is as follows: Cys-Tyr-Ile-Gln-Asn-Cys-Pro-Leu-Gly.Write a messenger RNA sequence for that sequence. Write the sequence of the two strands of DNA nucleotides that carry the information. for that protein.
- A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.The relaxation of base-paring rules between the TRNA and MRNA is termed as Answer:
- Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’Using the codon given for each amino acid (Find the table yourself) write the base sequence of mRNA that would translate the synthesis of the following pentapeptide:Arg · Ile · Cys · Tyr · ValThe following RNA sequence represents a small messenger which can be translated in a prokaryotic cell: 5'-ACGAAUGCACAGUAAAACUGGCUAGCGUAGGCUGA-3 Assume that the messenger RNA is translated in the cell, using the correct machinery and signals required for accurate protein synthesis. Using this RNA sequence and the Genetic Code Dictionary (see your textbook for the dictionary), solve the following problems A. Write the sequence of a protein that would be translated from this mRNA, using the appropriate stop and start signals, and indicating the correct termini of the protein product. B. Suppose that the underlined A in the sequence is changed to a U. Write the expected protein product of this mRNA.
- Using the codon given for each amino acid (Find the table yourself) write the base sequence of mRNA that would translate the synthesis of the following pentapeptide:Arg · Ile · Cys · Tyr · VaBelow is a diagram of charged tRNAS in the active site of the ribosome during translation of the MRNA into protein. What would be the codon in the mRNA that base pairs with the anti-codon in the t- RNA charged with Glu (Glutamic acid) ? HINT: Check the genetic code table/chart. X. Ala Arg Cys Gly Met Trp Leu Glu TRNA B TRNA A A 5'-AAC-3' 5'-CUU-3' 5'-GAA-3' 5'-AUG-3'Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
![Biology (MindTap Course List)](https://www.bartleby.com/isbn_cover_images/9781337392938/9781337392938_smallCoverImage.gif)
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
![Biology (MindTap Course List)](https://www.bartleby.com/isbn_cover_images/9781337392938/9781337392938_smallCoverImage.gif)