AKS 5c1: The model below represents the process of protein synthesis. What isthe best description for what occurs during process A and process B in themodel? *AA AGATIT TT GCITG GCITAG|AAMGAAMAQIBphenyl-alanineleucinealanineglycinemethionineH iysineProcess A is showing transcription, which uses a DNA template to create an mRNAcopy of the genetic code. Process B is showing translation, which uses the MRNA tocreate a polypeptide chain.Process A is showing translation, which uses a DNA template to create an MRNAcopy of the genetic code. Process B is showing transcription, which uses the MRNA tocreate a nolynentide chainAT AMAIIBmethionine lysinephenyl-alanineleucinealanineglycineProcess A is showing transcription, which uses a DNA template to create an MRNAcopy of the genetic code. Process B is showing translation, which uses the MRNA tocreate a polypeptide chain.Process A is showing translation, which uses a DNA template to create an MRNAcopy of the genetic code. Process B is showing transcription, which uses the MRNA tocreate a polypeptide chain.Process A is showing transcription, which uses the mRNA to create a polypeptidechain. Process B is showing translation, which uses a DNA template to create anMRNA copy of the genetic code.Process A is showing translation, which uses the mRNA to create a polypeptide chain.Process B is showing transcription, which uses a DNA template to create an MRNAcopy of the genetic code.

Name: AKS 5c1: The model below represents the process of protein synthesis.
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: AKS 5c1: The model below represents the process of protein synthesis. What isthe best description for what occurs during process A and process B in themodel? *AA AGATIT TT GCITG GCITAG|AAMGAAMAQIBphenyl-alanineleucinealanineglycinemethionineH iysine

Central Dogma of Molecular Biology explains the flow of information from DNA to RNA and then to…

Answered: AKS 5c1: The model below represents the…

Science

Biology

AKS 5c1: The model below represents the process of protein synthesis. What is the best description for what occurs during process A and process B in the model? * TT AA AA GAA IG |A AMGAAGI IB FA

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

pcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:
10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence an
GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
AGUCAGUCAG The codon chart is shown below, what amino acid sequence does the MRNA sequence: 3' UUUCCUCAA 5' code for? RNA Codon Chart 31 Alanine G U A Tyrosine Stop Valine A G Cysteine U 3' U G Stop G Tryptophan 3' G 5' Arginine G U A Leucine Serine A Lysine A U Proline G Asparagine leucine-threonine-glutamic acid asparagine-serine-phenylalanine serine-histidine-glutamine phenylalanine-proline-histidine phenylalanine-proline-glutamine Serine Glutamic acid Aspartic acid Histidine Glutamine Arginine Isoleucine 2 Threonine Methionine Q
You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosome
SA p PDF as trasc d PDF During the translation of an mRNA segment, different activated tRNAs (aatRNAs)-specified here by their anticodons written 3' to 5' bind through hydrogen bonds to mRNA in subscripts-successively codons in the following order: Teas fill PDF Cave UNOFFIC aatRNAGAA binds, then aatRNACAC, then aatRNAUUG, then aatRNAGUU, then aatRNAGUG, then aatRNAGAC What would the sequence of that mRNA segment be? O GAA CAC UUG GUU GUG GAC O CUU GUG AAC CAA CAC CUG O CTT GTG AAC CAA CAC CTG O Glu-His-Leu-Val-Val-Asp hu O Search PD maste omiss
Explore: Codons Found in Messenger RNA Second Base U C A Cys u Cys c Stop A G Phe Ser Tyr Tyr Stop Stop His Phe Ser Leu Ser Leu Ser Trp Leu Pro Arg Arg Arg G Leu Pro His Leu Pro Gin Leu Pro Gln Arg le Thr Asn Ser U A lle Thr Asn Ser le Thr A Lys Lys Arg Arg Gly Gly A Met Thr Val Ala Asp Val G Val Ala Asp Glu Ala Gly Gly Val Ala Glu Mutation #1: • Change the Mutation to RED Original DNA Sequence: TACAC CTTGG CCGACGACT mRNA Sequence: A UGUG GA ACCG CUG C UGA Amino Acid Sequence: MET -TRP- ASN - ARG- CYS - (STOP) Mutated TAC ATC TTG GCG ACG ACT DNA mRNA AUG Amino Acid МЕТ- MET - Will this mutation have an effect? What kind of mutation is this? First Base Third Base
Name: Clas: Date: Transcription 3" ATGACGGATCAGCCGCAAGOCGGAAfTGGCGACATAA UACUGCCUAGUCGGCGUU 3 5' WA WAW TACTGCCTAGTCGGCG TCGCCTTAACCGCTGTATT 3' 6 Label the diagram as you read the following passage. Transcription is the process cells use to copy information from DNA into messenger RNA copies. Part of the chromosome's tightly wound-up long strand of DNA is "loosened" to allow for RNA polymerase room to copy part of the DNA. Think of this as opening a page out of a giant book with thousands of pages to make a copy of just that one page. One side of the DNA strand is the template strand (or anti-sense strand) and is used by an enzyme called RNA Polymerase to create the messenger RNA. RNA Polymerase is directed by a bunch of proteins called transcription factors to the spot it needs to start copying. RNA Polymerase reads the template strand from the 3' end to the 5' end and creates a messenger RNA strand that is complementary to the template strand. In the diagram above, you can see that…
D. The sequence of a eukaryotic gene is given below, where in boed an inset containing: 5'GA TTATGGAATTCACCTAT GATCGCAT GGCCATTGAACCT 3 3CTAATACETTAAGTGGATA CTAGCGTA CCGGTAACIT GGA 5 A. Write the sequence of the WRNA produced by its process of transcription and of wRNA that is transferred to ribosomes in order to produce the peptide B. A mutation has occured in the above gene. The GIC pair highlighted replaced by T/A. Cells that are homozygous for that mutation become Cancerous. Do think this gene is a you proto-oncogene? or a tumor suppressor gene and why? describes D₂. The following family tree is given which the way inheritance of a dease. It is noted that only one of its two persons generation I is heterozygous and that one of the individuals in subsequent generations exhibits unexpected Phenotype. Individuals II4 and III2 show its phenotype disease. The remaining individuals have normal phenotype. α
Quick activity Use the genetic code to translate the following 30 nt mRNA sequence: AUGAUCCUAGGGUGCAUGAUGCCAAAAUAA Prezi 1st letter UUU Phe UCU U UUC JUA UUG U CUA CUG Leu AUU A AUC lle AUA CUU CCU C CUC Leu CCC Pro CCA CCG UAU UCC Ser UAC UCA UAA UCG UAG ACU ACC Second Letter ACA AUG Met ACG C GUU GCU G GUC Val GCC GUA GCA GUG GCG AAU Thr AAC AAA AAG Ala CAU His CAC CAA Gin CAG GAU GAC A GAA GAG Tyr UGU Cys U UGC Stop UGA Stop Stop UGG Trp CGU CGC Arg CGA CGG Asn Lys Glu G AGA AGG Asp GGU Arg DCAG DCA AGU Ser U letter AGC GGC Gly GGA GGG A U VAG U JOJO 3rd G Alb
point: Gene expression and gene regulation - Google Chrome 1/mod/quiz/attempt.php?attempt=D1168284&cmid=3372885 5. uc The following segment of DNA codes a protein. The uppercase letters represent exons, the lowercase letters red introns. Draw the pre-mRNA, the mature mRNA and translate the codons using the genetic code to form th protein. Identify the 5'UTR and 3'UTR. out of 5'-AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3" g question A B. 三 X2 =三三囲 Y pre-MRNA:| I囲2 L
BONUS: In Bacteria, recognizes the Ribosomal Binding site on mRNA and catalyzes formation of peptide bonds during translation (answers must be in correct order) O aminoacyl tRNAses; aminoacyl TRNA synthetases ribosomal protein translation factors; ribosomal protein initiation factors O helicase; gyrase O 165 rRNA; 23S rRNA