1. What structures are these DNA strand likely to adopt in solution (assuming sufficient salt concentration to permit any hybridisation as appropriate)? Draw your answers depicting the hybridisation. a) GCC TTG AGC TTT TTT GCT CAA GGC (b) ATG ACT CTC GAG AGT CAT TTA TTA

1. What structures are these DNA strand likely to adopt in solution (assuming sufficient salt concentration to permit any hybridisation as appropriate)? Draw your answers depicting the hybridisation. a) GCC TTG AGC TTT TTT GCT CAA GGC (b) ATG ACT CTC GAG AGT CAT TTA TTA

Name: 1. What structures are these DNA strand likely to adopt in solution (
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 1. What structures are these DNA strand likely to adopt in solution (assumingsufficient salt concentration to permit any hybridisation as appropriate)? Drawyour answers depicting the hybridisation.a) GCC TTG AGC TTT TTT GCT CAA GGC(b) ATG ACT CTC GA

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 27CTQ: Transcribe and translate the following DNA sequence (nontemplate strand): 5'- ATGGCCGGTTATTAAGCA-3'

See similar textbooks

Similar questions

Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT GGA CAT TTC 5' O 5' GCG TCA CCT GTA AAG 3' O 5' GAA ATG TCC ACT GCG 3' O 5' GCG UCA CCU GUA AAG 3' O 5' GAA AUG UCC ACU GCG 3'
1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? op 1: 3'-CAGTTAGTCA-5' op 2: 3'-TGACTAACTG-5' op 3: 5'-TGACTAACTG-3' op 4: 3'-TGACTAACTG-5' b) What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3' op 1: 5'-TAGCGTTGACAGTGATA-3' op 2: 5'-TAGTGACAGTTGCGAT-3' op 3: 5'-ATCACTGTCAACGCTA-3' op 4: 5'-UAGUGACAGUUGCGAU-3'
1.) A portion of a strand of a much longer molecule has a nucleotide sequence AGC – AGG – CAG - ATC, if this strand is replicated, what will be its complimentary strand? a.)TCG – TCC – GTC - TAG b.)AGC - AGG – CAG - AUC c.)AGC – AGG – CAG - ATC b.)UCG – UCC – GUC – UAG 2.)If the environment gets cold, we often shiver to____ a.)decrease body temperature b.)keep body temperature the same as the external temperature c.)regulate blood pressure d.)increase body temperature 3.)How does a neuron transmit a message from cell to cell? A nerve impulse travel_ a.)from the end of the axon, through the cell body up to the dendrite’s terminal, then across the synapse to the axon of another neuron b.)from the dendrites of one neuron to the dendrites of another neuron passing the cell body to the synapse of the axon c.)from the end of dendrite, through the cell body, down the axon terminals, then travels across the synapse to the dendrite of another neuron d.)from the axon of one neuron to the…
1. A. Fill in the complementary bases for the blank DNA strand given below: ATGAAGG ATAAAA GAACAGTGG CGTGA
5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four different individuals, one wild type and three mutants. Wild Type 5'-TTATCCATGATCGGATCGATCCATTAGCCGA-3' 3'-AATAGGTACTAGCCTAGCTAGGTAATCGGCT-5’ Mutant I 5'-ATCCATGATCGGATTGATCCATTAGCCGAAT-3’ 3'-TAGGTACTAGCCTAACTAGGTAATCGGCTTA-5’ Mutant II 5'-CCGTTATCCATGATCGGATAGATCCATTAGCC-3’ 3'-GGCAATAGGTACTAGCCTATCTAGGTAATCGG-5’ Mutant III 5'-CACCGTTATCCATGATCGGAACGATCCATTAGC-3’ 3'-CAGGCAATAGGTACTAGCCTTGCTAGGTAATCG-5’ a) Identify the open reading frames in each sequence of DNA and translate them into proteins. Write down the sequence of amino acids that will be obtained after translation: b) Which of the mutations above would be least likely to cause a change in the function of the protein? Why? c) Which of the mutations above would probably cause a major disruption in the function of the protein? Why?
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity
For the chromatogram below, what is the sequence of the template DNA from base 115 to 125? CTGTGTGAAA TTGT TA T C CGC T CACA A T TCCACA CA A CATACGAG CCGGAAG CA T AA 110 120 130 140 150 160 СТТТААСАAТА ТАTTCAATTТС ATAACAATTTC GAAATTGTTAT
32)An origin of replication is given below. Sequences of selected parental strand regions are given. The directionality of the bottom parental strand is indicated. Use the diagram to answer the corresponding questions. #2 *1 CTAAGCA ATCGAGG XXXXX XXXX 3' ICTAGTT 5' ge exon #3 a.) On the diagram, label the 5' and 3' end of the top strand of parental DNA b Draw arrows to indicate direction of DNA synthesis for each of the 4 daughter strands. e) For each daughter strand, specify if synthesis is continuous or discontinuous. d) On your diagram, label the 5' and 3' ends of the newly synthesized daughter strands e.) Which parental strands are the template for leading strand synthesis? (# 1- 4) Strand # Strand # f.) Which parental strands are the template for lagging strand synthesis? (# 1- 4) Strand # Strand # g.) What is the specific sequence of the primer required to start DNA replication ior strands 1 and 3? Assume the primer will bind to the location where the base sequence is given on…
The following is a section of DNA removed from a cell nucleus:5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?
28.Bacteria X contains the double stranded DNA sequence below. Our task is to design a labelled primer (probe) to detect this sequence. Which sequence below can be used for this task? Identify the single most correct answer below. * indicates a label 5' ATGCTTTTTTTAAACCCCGGGGTTTT 3' 3'TACGAAAAAATTTGGGGCCCCAAAA 5' a) 3' AATTTGGGGC* ( b) 3' ATGCTTTTTT* ( ) c) 5' TTTAAAGGG* 19 ( ) d) 5' ATGCTTTTTT* ) e) a and b () f) a and d 23 g) b and d 29.Ames assay is patented, so 2nd yr microbiology students devised a new assay where wild type GFP (green florescence protein AKA light producing) is used as the target gene, for mutation rate analysis. When compound A is added, even in very low concentrations, all colonies formed end up producing light (produce fluoresce). Therefore, one can conclude that compound A is a strong mutagen. () True False 30.The consensus SD (Shine/Dalgarno sequence) is 5' AGGAGGU. Identify the single most correct answer below. a) The SD sequence 3' AGGAGGU is stronger than…
Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT GGA CAT TTC 5'
4) Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA Template Strand: TACACATCACGCTCAACT a) What would be the amino acid sequence coded for by the template strand of the DNA molecule above?