BIOLOGY
BIOLOGY
12th Edition
ISBN: 9781260169614
Author: Raven
Publisher: RENT MCG
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 52, Problem 1DA

Data analysis Two different genes have mutant alleles that cause this spotting phenotype. One gene encodes a signaling molecule. What Is the likely function of the other gene product?

Expert Solution & Answer
Check Mark
Summary Introduction

To determine: The function of other gene product in spotting phenotype, if one gene encodes a signaling molecule.

Introduction: A mutation can be defined as a sudden change that occurs in the DNA sequence, during DNA replication. It can also be caused by exposure to specific chemicals or radiation. Mutation contributes to genetic variability.

Explanation of Solution

Neural crest cell under the surface of ectoderm differentiates into pigment cells of the skin. Survival and migration of these cellsare affected by a mutation in genes leads to white spotting in the skin. Two different genes have a mutant allele that causes the spotting phenotype in humans and mice. One gene act as a signaling molecule then the other is likely to be a receptor for the molecule.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!
Students have asked these similar questions
4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5..ТТCGAGCTСТСGТCGTCGAGATACGCGATGATATTACTGGTААТАТGGGGATGCАСТАТС..3' 3'...AAGCTCGAGAGCAGCAGCTCTАTGCGСТАСТАТААТGACCATTATAССССТАСGTGATAG..5' * promoter i. Mutant A has a single base pair substitution with the T/A being replaced with C/G base pair at position 35 (position denoted by the * in the sequence above). ii. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above).
Match each example of mutation to the correct effect on function. Hypomorphic mutation Hypermorphic mutation Antimorphic mutation Neomorphic A deletion results in the loss of part of a protein and the protein retains some of its normal activity. A mutant allele makes a protein with increased cataytic activity. A mutant form of a transcription factor binds new DNA sequences to activate different genes. A mutant from of a receptor protein interferes with the function of the wild-type receptor through heterodimerization.
Protein P, normally stimulates apoptosis or cell death when activated. Consider a cell with a mutation in one allele such that protein P is always expressed and active, while the other allele of gene P is deleted. Which of the following is true for this cell? Gene P is a proto-oncogene, and the phenotype of the cell is transformed. Gene P is a proto-oncogene, and the phenotype of the cell is not transformed. Gene P is a tumor suppressor gene, and the phenotype of the cell is not transformed Gene P is a tumor suppressor gene, and the phenotype of the cell is transformed 로
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
Biology
ISBN:9781305967359
Author:STARR
Publisher:CENGAGE L
Text book image
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Animal Communication | Ecology & Environment | Biology | FuseSchool; Author: FuseSchool - Global Education;https://www.youtube.com/watch?v=LsMbn3b1Bis;License: Standard Youtube License