Q: Which of the following statements is FALSE? Select one: a. G-C bonds are much more resistant to…
A: DNA and RNA show our genetic constitution.
Q: Why should a young culture be used in gram staining rather than an old culture? b. Why is it…
A: To answer this question first, we need to understand what is gram staining and what are the steps of…
Q: IMPORTANCE OF TEMPERATURE REGULATION IN ANIMALS???
A: Animals are the developed living organisms with compare to other organisms. Animals are…
Q: Magnifiers cause sticky eye .A true .B false
A: You might well have woken up having wet or crusty material in your eyes if you have allergy or a…
Q: Organisms with a notochord that extends the entire length of the body [ Choose ] throughout its life…
A: Animal kingdom includes- eukaryotes having multicellular structure.
Q: what is a transport medium; give specific examples and state their purpose
A: What is a transport medium; give specific examples and state their purpose?
Q: This hormone’s activity counters many of the growth-promoting effects of other hormones. A.…
A: Auxin, abscisic acid, ethylene, gibberellic acid, cytokinins, salicylic acid, strigolactones,…
Q: presence
A: No , the number of he chromosome doesn't affects the sexual reproduction. For example ,…
Q: 7. Some animal species are completely or primarily asexual. What are two conditions that appear to…
A: Introduction:- Asexual reproduction produces offspring in certain animals, while sexual reproduction…
Q: Briefly discuss the steps in replication.
A: Replication is the process by which a double-stranded DNA molecule is copied to produce two…
Q: Which method involves using the cell’s own repair system of a DNA strand? Group of answer choices…
A: Technology is utilized in science, while science is used in technology. Both are vital to our…
Q: Match the organ system with the reproductive function it provides. Reset Help Lymphatic system :…
A: A reproductive system is a system of organs and processes that take part in the reproduction or…
Q: 9. Complete the table (gnore sex). Phenotype Proportion Observed + (wild-type) Vestigial wings…
A: Introduction "Genotype" refers to an organism's complete genetic information. The observed…
Q: speciation in the Galapagos finches occurred through geographic isolation
A:
Q: a. types of eggs of Ascaris lumbricoides and their differences b. which is more infectious Taenia…
A: Introduction A parasite is a organism that lives on or in its host and feeds on or at the expense of…
Q: Question What does the hemoglobin graph regarding YO2 represent?
A: Hemoglobin, is an iron-containing oxygen-transport metalloprotein found in all vertebrates' red…
Q: COVID-19 MRNA vaccines have the potential to stimulate the following types of immune attack against…
A: CoViD-19 vaccines based on mRNA technology go inside the host cells, get the spike protein of the…
Q: Q.A3 (a) The biological tissues are complex, anisotropic conductors with resistive and reactive…
A: Tissue: Tissue is made up of cells that have similar features and operate together as a unit. The…
Q: what casues leukopenia? detailed explanation
A: Introduction Leukopenia is a condition in which the total number of white blood cells is reduced.…
Q: Discuss in detail, how you would produce recombinant protein subunit vaccines for Influenza virus.
A: Recombinant protein vaccines, which are also known as recombinant subunit vaccines, are designed…
Q: Identify the type of trichomes based on presence of glands (glandular, non-glandular); based on…
A: Trichomes These are defined as the specialized epidermal cells having fine outgrowths that are…
Q: Destroying forests increases the carbon in the atmosphere. True O False
A: Deforestation- cutting down of trees is known as deforestation. Cutting of trees in forests and…
Q: Define what is meant by a ‘balanced translocation carrier’ and how such an individual might appear…
A: A balanced or chromosomal translocation is a condition where portion of a chromosome has severed and…
Q: 9. After binding to an antigen, T cells activate and differentiate into one of three cell types.…
A: Answer : T cell divided into three types of T cells when bonded with an antigen these are :…
Q: The dose to the body was 40 mSv. Find the dose to the Thyroid in mrem?
A: The mSv is the SI unit called milisievert. It measures the average of the accumulated radiation…
Q: discuss the what is cyst passers and its type 2. which body organs do E. histolytica resides? 3.…
A: Entamoeba is parasitic or can be commensal organism . It is characterized by presence of tiny one…
Q: मे पोng चं मेट Pिoबशाळी छी वेंरणमीकी उणटरका्ेर गर छ tabeted पस (व) Phoठाihade भहण्परि पृषष्प? ce)…
A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like helical structure which serves as genetic…
Q: In an insect with an early-loss survivorship curve most individuals die soon after they hatch most…
A: Survivorship curve describe the pattern of the number of individuals born and number of individuals…
Q: a. List two compounds that can be produced from pyruvate in skeletal muscle b. What are the enzymes…
A: Metabolism is defined as the entire quantity of biochemical events that occur in an organism's cells…
Q: Protozoan infections are rare in the UK and, therefore, are of little importance”. State whether you…
A: Protozoan contaminations are responsible for illnesses that influence various sorts of creatures,…
Q: What was the first piece of evidence for evolution that spired the question if organisms changed…
A: Biological evolution or organic evolution is defined as "the process of continuity of life with…
Q: The conditions of gigantism and pituitary dwarfism are extreme opposite conditions of adult height.…
A: Introduction :- Gigantism is a relatively unusual disorder in which a kid or adolescent's body…
Q: 1.In cabbage butterflies, White wings are dominant to yellow wings. If a Ww butterfly is crossed…
A: Genes are made of DNA, DNA or deoxyribonucleic acid are the functional units of heredity. DNA makes…
Q: Which of the following is an example of a homologous structure? O the jointed leg of an insect and…
A: Homologous structures are organs or skeleton features seen in animals and organisms which, due to…
Q: shake it. closed checked to ensure that it does not exceed the maximum permissible concentrations of…
A: Science is humanity's greatest blessing. It has altered human existence; nothing finer could have…
Q: Name five (5) Philippine Plant Extracts that are used or are being studied as alternatives for drug…
A: Natural products is one of the key sources of drug and cosmetic in pharmaceutical and FMCG/cosmetic…
Q: 5. Do we see logistic growth in real-world populations? If so, give an example.
A: Introduction The increase in the number of persons on the planet is known as population growth. Our…
Q: a. List two compounds that can be produced from pyruvate in skeletal muscle b. What are the enzymes…
A: Pyruvate conversion in skeletal muscle :-
Q: What is the structure of the renal corpuscle ?How does its structure contribute to the filtering of…
A: Introduction The blood-filtering component of the nephron is the renal corpuscle (also known as the…
Q: What is the Fluorochrome staining technique for Mycobacterium
A: Mycobacterium - they are a type of germ. There are different kind of mycobacterium. Still others…
Q: Always give eye drops only for acute loss of vision .A true .B
A: Most of the eye drops are used for keeping the eyes moist. Moist eyes in comparison to dry eyes…
Q: 3.In guinea pigs, short hair is dominant over long hair. If a short haired SS guinea pig is crossed…
A: A monohybrid cross is a Mendelian cross that is performed when studying a single trait to understand…
Q: What diseases are associated with lysosomes? O Familial Hypercholesterolemia and Infectious diseases…
A: Lysosomal storage disease is the type of disease in which offspring receives the defective gene from…
Q: If 48 % of the population is heterozygote for a certain gene, what percentage of the population will…
A: When a population is in Hardy Weinberg Equilibrium, it is said to be in genetic equilibrium.
Q: Which is a keystone species a frog or grasshopper?
A: Ecosystem balance, often known as "ecosystem homeostasis," is influenced by both factors that tend…
Q: What is the evolutionary trend in the alternation of generation in plants? Further elaborate on the…
A: Answer
Q: What diseases are associated with mitochondria? O Familial Hypercholesterolemia and Infectious…
A: Introduction Mitochondria is the site where ATP synthesis takes place. It is known as power house of…
Q: What are considered as "Organelles for structural support, movement, and communication between…
A: Organelle is a biological structure that performs a distinctive function inside a cell. Organelle…
Q: On the basis of the information provided, is the inheritance of haemophilia: autosomal or…
A: Hemophilia is a form of clotting deficiency due to lack of clotting factor 8 and 9. Most affected…
Q: Which functional groups of amino acids are involved in the formation of a peptide bond? O The…
A: Amino acids are chemical molecules that combine to make proteins, hence, they are referred to as…
Step by step
Solved in 3 steps
- Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF?The complementary sequence for the strand given below is 5' AUU CCU CCC AAU AUG 3' O 5 CAUAUUGGGAGGAAU 3 O 5' UAAGGAGGGUUAUAC3' O 3' GUAUAACCCUCCUUA 5' O3' AUU CCU CCC AAU AUG 5'What is the DNA template for the RNA sequence 5' UAACGGAGCCUAAUC 3'? O 5' GAUUAGGCUCCGUUA 3' O 5' AUUGCCUCGGAUUAG 3' 5' GATTAGGCTCCGTTA 3' 5' TAACGGAGCCTAATC 3' O 5'ATTGCCTCGGATTAG 3'
- Below is a sequence of DNA.5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF? How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF? Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortestORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longestORF (from N to C-terminal end)?5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13For the following sequence please design an 18 base pair REVERSE primer. ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAG
- The BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U P с > < A G U UUU UUC Phe UUA UUG CUU CUC CUA CUG L GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Cys UAA Stop UGA Stop A Trp UAG Stop UGG CAC His CGU J CGC CAA I CGA Gin CAGG CGG AAA 1 AAG Lys UGU UGC AAU Asn AGC} AAC GAC Asp GAA GAGGIU For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS Paragraph V Arial G 1 AGA 1 AGG GGU GGC GGA GGG Arg Ser Arg Gly V DCAG DCA DOA UCAG Third letter 10pt < Av V IX Q ... O WORDS POWERED BY TINYWhich amino acid sequence will be generated? 5'-GAAUGUCUUCGUUAUUGAUGUAGAA-3'Determine the isoelectric point of the peptide product of the mutated sequence: 5' - AUG UCC AUG AUU CUG GAA AUU ACC UCC AUC AUG AAG CGC UGA CCC AUU AUU AA - 3'
- You are sequencing the genome of newly discovered bacterium, and know nothing of its sequence except that it is one single circular chromosome about 6,000,000 bp long. Your raw sequencing data, from two reactions, are given: 5'-ACCGTCGGTTACGCTTAGA-3' 5'-GTTACGCTTAGATAACACAAG-3' Based on this data, give the sequence of one sequence read: Based on this data, give the sequence of one sequence contig: C. So far, the researchers have assembled all the data they have into three sequence contigs. Have they sequenced the whole genome? Briefly explain, in one or two sentences.Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'The Universal Genetic Code Table can be used to determine the gene product of a given nucleotide sequence. Universal Genetic Code Table Second Letter A G UUU } Phe UCU UAU } Tyr UGU } Cys UUC UCC UAC UGC Ser UUA } Leu UCA UAA STOP UGA STOP UUG UCG UAG STOP UGG Trp CUU CAU CCU CCC CGU } His CUC CAC CGC Leu Pro Arg CUA ССА CAA CGA } Gin CUG CCG CAG CGG AGU } Ser AUU ACU AAU } Asn AAC AGC AUC A AUA Ile ACC Thr ACA AAA AGA } Lys } Arg AUG Met ACG АAG AGG GUU GCU GAU GGU } Asp GUC GCC GAC GGC Val Ala Gly GUA GCA GAA GGA } Glu GAG GUG GCG GGG The table below represents the transcription of a short peptide sequence in a human cell. Place the amino acid abbreviations that correspond to the nucleotide sequence when it is translated. DNA TTG CTG TGT GAG GCA MRNA AAC GAC ACA CUC CGU Protein (реptide sequence) :: Ala :: Arg : Asp :: Asn :: Сys : Gln : Glu : Gly :: His : lle : Leu : Lys : Met : Phe :: Pro :: Ser :: Thr : Trp : Val Third Letter First Letter