Which of the following adaptations exploits the viscosity property of water? (Check all that apply) droplets of oil on algae long, filamentous appendages high percentages of fat a gas-filled swim bladder streamline body shape
Q: A 65-year-old man presents with facial weakness. He says he noticed that his face appeared twisted w...
A: Facial nerve schwannoma : it is Benign peripheral nerve sheath tumor that arise from Schwan cells. ...
Q: How is a protein with a proper sequence generated?
A: Amino acids are biomolecules made up of two functional groups: an amino group (-NH2) and a carboxyl ...
Q: What is the protective function of mucus?
A:
Q: How Sunscreen or Sun Filter ingredient's SPF is measured?
A: As per Bartleby guidelines, we are allowed to answer only one question at a time, please post other ...
Q: what is the probability that he might be a carrier of the recessive gene?
A: Cystic fibrosis is associated with the CFTR gene that encodes a protein that helps thin the mucous l...
Q: Suppose a person with the dominate blood form and a person with the other dominate blood form type g...
A:
Q: what are the different taxonomic classifications of protozoans
A: Introduction :- Protozoa are heterotrophic, unicellular eukaryotic organisms. They can either live f...
Q: Why would multi-gene families complicate things in terms of being sure of which member of the family...
A: It is the gene which ultimately determines the phenotype. Thus there is a direct relationship betwee...
Q: Explain Biochemical Evidences. How can it support evolution
A: Introduction :- In biology, evolution refers to the change in a species' features over numerous gene...
Q: Look at these two plates. Which organism is most susceptible to antibiotics?
A: Q. Look at these two plates. Which organism is most susceptible to antibiotics?
Q: In a breed of horse, they can be purebred black (B), purebred white (W) or blue roan (black and whit...
A: horses can have different coat colors. they can have white, black, brown or roan.
Q: Molecule #T ajvvnat up? (Cal Lipiu, Acid). b)Within the group, how would you classify it? CH̟OH a) H...
A: First molecule shown is a monosaccharide. Different or same monosaccharides join via glycosidic link...
Q: 8. In which of these clades (Deuterostomia, Lophotrochozoa, Ecdysozoa, Porifera, and Cnidaria) would...
A: Your answer has strating in step 2. Step 2 image is made by me, in MS word. This image not copied fr...
Q: Which adipokine promotes inflammation and causes insulin resistance? A. Leptin B. Adiponectin ...
A: Adipokines are cytokines that are released from adipose tissue. These have been associated with cont...
Q: How did the energy-related organelles arise?
A: The cell is usually defined to state that they are been as the most fundamental structural and funct...
Q: Sexual adjustment is best viewed as a relationship issue, not just one partner’s problem. T or F?
A: Human beings are social animals. The first man on Earth was a cave man. No societal rules and regula...
Q: Select all true answers ng plant the endosperm and hormones impose dormancy in seeds O imbibition is...
A: Germination is the occurrence of plant fate within the seed that gives rise to seedling and further ...
Q: Round seed is dominant over wrinkled. Yellow cotyledon is dominant over green. Full pod is dominant ...
A: In this question, it is not mentioned whether it is dominant homozygous or dominant heterozygous. To...
Q: environment
A: Insects adaptations include mouth parts, the ability to fly,leg types and body shapes... They die, t...
Q: for
A: Generally only about 10%of energy at one level is available to the next level... This loss of energy...
Q: How might culture age affect the results of a spore stain? O If the bacterial culture is too young, ...
A: Bacteria are single-celled, tiny creatures that may enter healthy tissues and grow rapidly. The bact...
Q: What difference between RNA and DNA helps to explain the greater stability of DNA? What implications...
A: Deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains that twin around eac...
Q: Which of the following is NOT a defining chordate characteristic? O post-anal tail O vertebrae O pha...
A: Chordate characteristics include presence of notochord, a dorsol hollow nerve cord and paired pharyn...
Q: Identify and explain the process by which cells expel materialsin bulkb
A: The movement of chemicals through the cell membrane is referred to as cell transport. The ability of...
Q: Which type of molecule recognizes macromolecules that are present in/on certain groups of pathogens?...
A: Introduction: Phagocytosis is a process in which the phagocytic cells engulf the microbes. It is an ...
Q: mosses including their life cycle
A: Solution : Mosses are flowerless small plants found under the division Bryophyta along with liverwor...
Q: Identify and explain what insects are expected to have the most sclerotized heads? Does an exoskelet...
A: Scelerotin is typically a brown coloured substance found in cuticles of insects. Scelerotin is forme...
Q: Give the genotype of the parents if their phenotypic ratios are the following. You may use any lette...
A: Introduction:- The genotype of a person can reveal their genetic makeup. It specifies which characte...
Q: Explain : Vpr counteracts LAPTM5 to promote HIV-1 infection in macrophages
A: Vpr means viral protein R and it is a HIV gene and protein product. This gene is responsible for vi...
Q: What is genetic disorders? Explain by giving an example.
A: Genetics is described as the branch of biology that focuses on the study of genes, their inheritance...
Q: Determine if the following are considered facts or opinion using the evidences provided. Write FACT ...
A:
Q: Please help Write a short sentence summary about taxonomy
A: Classification is very important in finding particular species of plant or animal in this vast varie...
Q: can you help me to identify by labelling the slides
A: This is the transverse section of loose areolar connective tissue. The labelled images attached step...
Q: If the template DNA sequence is 3' - CCC - ATA - GAG - AAA - 5' , then what is the corresponding dau...
A: DNA is molecule which is present inside a cell and contain the genetic information of an individual ...
Q: PHow does the oxygen binding curve of fetal hemoglobin differ from that of adult hemoglobin
A: Introduction: Haemoglobin is an iron-containing oxygen transport metalloprotein found in all vertebr...
Q: Which of the following is true about the movement of ions across excitable living membranes? Ions...
A: Introduction :- The thin layer that forms the outer edge of a living cell or a cell compartment with...
Q: Mammals are farther removed from echinoderms in phylogenetic alliance as they do with birds. Yet bir...
A: Birds and Mammals are different from each other in many morphological characters such as body hair, ...
Q: 5 Statement of the problem about this topic thank you Title: Effects of organic and special fertili...
A: Bitter gourds require a very hot and humid climate to grow well. Plant bitter gourd seeds grow in ...
Q: Which child is female 3 most likely an aunt of? O 1 O 2 3 4
A: DNA fingerprinting is a technology used to determine paternity, genetic relationships, and to solve ...
Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...
Q: if you were going to move a vesicle or organelle from one place to another within a cell, describe t...
A: If we were going to move a vesicle or organelle from one place to another within a cell,nuclear enve...
Q: Briefly explain heterotrophism
A: plants make – or produce – their own food so, they are referred to as producers. Their roots absorb ...
Q: If 100,000 normal human cells were plated in a petri dish, around how many normal cells would be est...
A: Introduction: If we start with one cell, when it divides, there are 2 cells in the first generation,...
Q: glutamate when it binds to postsynaptic AMPA receptors
A: glutamate is the main excitatory neurotransmitter in the central nervous system, it primarily intera...
Q: Review darwin's theory of natural selection. Write a paragraph reflection explaining a) what you lea...
A: Darwin's theory of natural selection:- Organisms with the strongest and most desirable characteristi...
Q: The image above shows a cross-section through a portion of the root of Phalaenopsis sp. stained with...
A: Phalaenopsis are commonly known as Orchids. They are monocots.
Q: 28. Given the relative proportion of DNA that directly codes for genes, is it reasonable to say that...
A: Introduction :- A gene is a basic unit of heredity in biology, consisting of a sequence of nucleotid...
Q: QUESTION 3 Immunological memory explains which of the following? O The ability of a helper T cell to...
A: INTRODUCTION Immunological memory The immunological memory explains the ability of the immune system...
Q: It a student placed a starch in the beaker liquid and iodine solution inside the dialysi tubing bag,...
A: Iodine solution is a good indicator molecule, especially a starch or glycogen indicator. It is a che...
Q: 1)What is a test-cross? 2)Why might a geneticist need to do a test-cross and how are the results us...
A:
Step by step
Solved in 2 steps
- Figure 28.3 Which of the following statements is false? Choanocytes have flagella that propel water through the body. Pinacocytes can transform into any cell type. Lophocytes secrete collagen. Porocytes control the flow of water through pores in the sponge body.A paramecium cell placed into a hypotonic solution will experience which of the following effects? expulsion of the excess water using its contractile vacuoles plasmolysis hemolysis shrinkage crenationMost marine invertebrates are osmotic conformers. How does their body fluid differ from that of sharks and rays, which are also in near osmotic equilibrium with their environment?
- An H+ ion is smaller than an H2O molecule, and a glycerol molecule, a three-carbon alcohol, is much larger. Both readily dissolve in H2O. Why do aquaporins fail to transport H+ whereas some can transport glycerol?All animals... (select all correct statements) are multicellular have true tissues are photoheterotrophs are unicellular are chemoheterotrophs are chemoautotrophsBriefly describe the function of the insect hindgut with respect to water and electrolyte balance. How does this help the insect's homeostasis? You should NOT make a list of everything the cell moves in and out. Generalize and summarize, and keep your answer short, Suhmit your answer tho "Suhmit
- This specialized channel proteins facilitates water transport through osmosis. Spectrins Aquaporins Clathrins Elastins 00Which of the following is an example of active transport? Uniporter Aquaporins Na+/K+ ATPase All of the aboveStriations, cylindrical cells, and multiple nuclei are observed in? skeletal muscle only cardiac muscle only smooth muscle only skeletal and cardiac muscles
- The function of the plasmodesmata is to provide communication channels for neighboring animal cells to exchange nutrients and ions. True FalseGoldfish are one of the most common aquatic pets. The average temperature to maintain healthy goldfish is between 72-75 degrees Fahrenheit. However, it is not unusual to find goldfish keeping office workers company in frigid cubicles as low as 68 degrees Fahrenheit. Mary noticed her goldfish opened and closed it’s operculum (protective covering for the gills) more often when the temperature in her office was warm. Worried, she may be harming her pet by keeping her office so cold, Mary set up an investigation to test the impact cold temperatures had on her goldfish’s respiration rate. Which of the following experiments would be best to investigate if goldfish maintain homeostasis during varying temperatures?Using the appropriate osmotic terms (hypertonic, hypotonic, or isotonic) describe what would happen to each organism in the following settings: A single-celled freshwater protist is placed into a beaker of salt water. A salt-water snail is mistakenly put into a freshwater tank. A head of lettuce is placed soaked in a sink of salt water. A carrot is soaked a sink of distilled, pure water.