Which of the following activities DOES NOT happen during the initiation stage of transcription? A. Use of RNA polymerase. B. Detection of TATA-box C. Attachment of transcription factors D. Addition of G' Cap and Poly-A tail A section of DNA has the following sequence of nitrogenous bases: CGATTACAG. Which of the following sequence would be produced as a result of transcription? A. CGTUUTCTG B. GCTAATGTC C. CGAUUACAG D. GUAAUGUC

Which of the following activities DOES NOT happen during the initiation stage of transcription? A. Use of RNA polymerase. B. Detection of TATA-box C. Attachment of transcription factors D. Addition of G' Cap and Poly-A tail A section of DNA has the following sequence of nitrogenous bases: CGATTACAG. Which of the following sequence would be produced as a result of transcription? A. CGTUUTCTG B. GCTAATGTC C. CGAUUACAG D. GUAAUGUC

Name: Which of the following activities DOES NOT happen during the initiati
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which of the following activities DOES NOT happen during the initiation stage oftranscription?A. Use of RNA polymerase.B. Detection of TATA-boxC. Attachment of transcription factorsD. Addition of G' Cap and Poly-A tailA section of DNA has the follow

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter14: Gene Regulation

Section: Chapter Questions

Problem 8TYU: Through alternative splicing, eukaryotes (a) reinforce gene inactivation (b) prevent transcription...

See similar textbooks

Similar questions

Explain the process of transcription in eukaryotic systems by considering the CDK9 gene (search more information about the function of CDK9 in relation to RNA polymerase II). If CDK9 is an example of a gene to be transcribed, explain from initiation, elongation, to termination with proteins involved, by including the important general transcription factors, mention which RNA polymerase.
Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very small gene. Transcription starts at nucleotide immediately following the promoter. The termination sequence is TATCTC. How many amino acids will this protein have? 5' TCATGAGATA GCCATGCACTA AGGCATCTGA GTTTATATCT CA 3' 3' AGTACTCTAT CGGTACGTGAT TCCGTAGACT CAAATATAGA GT 5'
How does the 4 feature of transcription factors namely the structural motifs of DNA binding protein, activation domains, multiple transcription factors and enhancers help in the design of a building block tool. U can use the SrY gene as ur building block tool. Pls explain in details using those features of the transcription factors. In 400 words
a. What is grey donut shaped object supposed to represent? b. Label with the word "promoter" where one might find the promoter region in this image. c. In the magnified insert, label the template strand that is being transcribed with the word "template". d. In the magnified insert label the 5' and 3' ends of the transcript. e. What entity functions to break the complementary base pairing of a gene at its transcription start site? CS Scanned with CamScanner
What is the correct order of events during transcription Group of answer choices a. Initiation, Elongation, Capping, Termination, Nucleotide Modification, Splicing, Editing, Polyadenylation b. Initiation, Capping, Elongation, Termination, Splicing, Nucleotide Modification, Editing, Polyadenylation c. Initiation, Capping, Elongation, Splicing, Editing, Nucleotide Modification, Polyadenylation, Termination d. Initiation, Elongation, Capping, Nucleotide Modification, Splicing, Editing, Termination, Polyadenylation
During the embryonic development of a fruit fly, bicoid protein regulates transcription in thenucleus. Transcription in fruit flies is similar to that in humans.The molecule that is most similar in function to the bicoid and the molecule that it binds to inorder to initiate transcription, respectively, are A. Molecule Most Similar to Bicoid Protein. Molecule that Bicoid Binds To RNA Polymerase DNA StrandB. Molecule Most Similar to Bicoid Protein Molecule that Bicoid Binds To DNA Polymerase DNA StrandC. Molecule Most Similar to Bicoid Protein Molecule that Bicoid Binds To RNA Polymerase mRNA StrandD. Molecule Most Similar to Bicoid Protein Molecule that Bicoid Binds To DNA polmerase…
Consider this list (below) of steps involved in transcription. These steps are out of order. TRANSCRIPTION: 1. mRNA travels through a nuclear pore and enters the cytoplasm 2. the mRNA polymerase attaches at the start of a specific gene 3. RNA polymerase reads the gene surface4. a transcription factor bonds to a promoter site5. DNA molecule is unwound 6. a complimentary mRNA is produced What is the correct order of this transcription?
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.
a. The promoter is to the right so transcription goes right to left.b. This sequence 5’ AGCTACGGGGTG 3’ is a part of the template strand from the MIDDLE of gene. Write it in the middle of one of your lines. Use pencil in case of errors. c. Write the sequence of the coding strand of DNA on the other line. d. Indicate the start of transcription with an arrow like this and write “promoter” where it must be located. e. Draw a thicker (or different colored) line to indicate a strand of newly synthesized mRNA. Label 5’ and 3’ ends. By the template sequence on your diagram, write the sequence of mRNA that is produced from this template. f. In what ways are the sequences of the coding strand and the mRNA similar? g. In what ways are the coding strand and the mRNA different?
5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP MOLECULAR...GENETICS. Describe gene regulation at transcription level. Explain the role of antsense RNA in control mechanism. Describe translational control mechanisms. Describe common DNA damages. Distinguish excision and mismatch repair. Describe the role of recA protein in recombination repair Elaborate on SOS repair mechanism. Define thymine dimer. How are they formed and repaired? Describe the molecular basis of mutation. 11 Leu+ Met+ Arg+ Write a detailed note on spontaneous mutation. Explain about mutant detection methods. Define reverse mutation. Describe the mechanism underlying Intragenic and intergenic suppressor mutations Describe the transposition mechanisms. 13 Vo LTE UNIT IV Time (Min) Describe the process of generalised transformation occurring in bacterial chromosome and plasmid. Elaborate on molecular mechanism and significance of transformation 22 Describe the process of…
Predict the state of transcription activation in the following scenarios: A. Regulated as usual B. Higher levels of transcription C. Lower levers of transcription Everything in the system is intact except activators can no longer bind to chromatin modifiers Everything in the system is intact except there are overly active histone deacetylases Everything in the system is intact except heterochromatin is constantly shifted to the form of euchromatin Everything in the system is intact except the main coactivator Mediator no longer binds to RNA Polymerase II