What is the role of his 12 in the RNase-catalyzed hydrolysis of RNA, as indicated i the Figure below? His 119 RNA CH₂ H H 3 H Base 2' OTH O -O-P-0 CH₂ H ΝΗ His 12 Base H O 0-P=O O H OH It acts as a general base, abstracting a proton from the 2' hydroxyl in order to increase its nucleophilicity. O It forms an H-bond with his119 in order to stabilize the transition state. It donates a proton to improve the quality of the leaving group. It works through concerted general acid-base catalysis with his119 in order to favour the products of the reaction. Two of the above are true.
Q: gluscose trasporter in teh liver cell binds with Km of 40mM. Calculate what fraction of vmax the Vo…
A: Km is the kinetic constant that determines the affinity of an enzyme to its substrate.Vmax is…
Q: 9. What are the primary differences between site-specific recombination and general recombination?…
A: Recombination is the process of reshuffling genetic material to create new combinations of genes…
Q: 10.32 Give an explanation for the Lineweaver-Burk plot for a certain enzyme-catalyzed reaction shown…
A: Michaelis Menten equation describes the mathematical relationship between initial rate of reaction…
Q: Given the graph below, what changes to % saturation of hemoglobin would you expect from the change…
A: Hemoglobin is a tetrameric protein, each subunit contains heme prosthetic group. One hemoglobin…
Q: Place the following molecules in order from highest to lowest phosphoryl transfer ability (most…
A: Phosphoryl group transfer ability is a measure of how good of a phosphate group donor a molecule is.…
Q: Provide a reasonable step-wise mechanism for the reaction below, involving TPP as a coenzyme (can…
A: Enzyme catalysis can occur via different mechanisms such as general acid/base catalysis, covalent…
Q: The scientific name of the fructose molecule shown below is CH2OH OH НО ОН CH₂OH
A: Fructofuranose is a structure which is similar to the furan ring, which has a five carbon membered…
Q: What is the effect of type 2 diabetes (T2D) on pentose phosphate pathway (PPP) flux? T2D facilitates…
A: In type 2 diabetes, the cells do not respond normally to insulin. The body develops what is known as…
Q: Of the allosteric enzymes listed below, which are suppressed by NADH? Select all that apply. the…
A: Enzymes catalyse biochemical reactions. Substrate binds to the enzyme's active site and is converted…
Q: The diagram to the right illustrates in panel A the N- acetyl-glutamate content of rat livers as a…
A: When amino acids are degraded in the tissue, they release ammonia. Ammonia is toxic to the cell so…
Q: An organism no longer needs to express a particular gene. What is one strategy it might use of the…
A: Genes are segments of DNA that can be translated into functional proteins. The collective process of…
Q: why are lysozyme and ovoalbumin the recommended standards used in the Bradford protein assay and why…
A: Lysozyme is an enzyme found in tears, saliva and mucus which plays a role in destroying bacterial…
Q: The effect of an inhibitor on an enzyme was tested and the experiment gave the results below. If…
A: Inhibition can be either reversible or irreversible. Reversible inhibition can be generally of 3…
Q: The C-2 epimer of A is [Select] [Select] H- Н- НО Н- -H CHO OH OH Н H OH НО НО OH -H -H Н- Н- CHO B…
A: Carbohydrates are polyhydroxy aldehydes or ketones. Monosaccharides are simplest carbohydrates:…
Q: The enzyme aldolase catalyzes the reaction shown in the glycolytic pathway: Aldolase Fructose…
A: The ratio of concentration of products to reactants for any reaction in a given condition at…
Q: We humans do not express an alpha-Galactosidase enzyme and therefore cannot break down stachyose but…
A: Stachyose is a tetrasaccharide made up of two , one and one . Stachyose can be represented as .Gal…
Q: You are studying a biochemical pathway that requires ATP as an energy source. To your dismay, the…
A: ATP is the energy currency that the cell spends on metabolic transactions. ATP is produced in two…
Q: Which of the following vitamins do you expect to enter the cell via diffusion (i.e., NOT need a…
A: Diffusion refers to the movement of a substance from a region of higher concentration to a region of…
Q: The equilibrium constant for the hydrolysis of the peptide alanylglycine (Gly-Ala in the reaction…
A: The Gibbs free energy (G) of a system is a measure of the amount of usable energy in that system.The…
Q: Describe why hydrogen, carbon, nitrogen, and oxygen can be considered the most important building…
A: A cell is the basic unit of life. Cells are made up of biomolecules like carbohydrate, proteins,…
Q: Diabetic patients may experience elevated levels of ketogenesis which, in turn, leads to acidosis.…
A: This buffer is responsible for maintaining the pH of blood plasma. Carbonic acid (H2CO3) is the…
Q: 1. Glycolysis can be summarized as a 6-carbon structure becoming two 3-carbon structures. To really…
A: In glycolysis, a 6-carbon molecule of glucose-6-phosphate is broken down into 3-carbon pyruvate. It…
Q: Which structure likely represents a GPCR? A B e C D
A: G protein-coupled receptors are abbreviated as GPCRs.These are integral membrane proteins…
Q: Most enzymes are quite specific, catalyzing a particular reaction on a set of substrates that are…
A: Specificity is a property of an enzyme which estimates the number of different chemical species…
Q: most organisms use D-glucose as a primary metabolic fuel. predict what would happen if only…
A: The question is asking us to predict the metabolic consequences if organisms, which normally use…
Q: You discover a new organism that contains enzyme that can break down beta(1,4) glycosidic linkages,…
A: There are four classes of biological macromolecules; proteins, nucleic acid, lipids and…
Q: 4. Graphing the results from kinetics experiments with enzyme inhibitors The following kinetic data…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: Ceramide is in which lipid class? A) triacylglycerols b) phospholipids c) glycolipids d)…
A: Lipids are a chemically diverse group of biomolecules that have two things in common:low solubility…
Q: Note: the reaction volumes will be 20 μL and n = 10 reactions! Assume you extract gDNA quantitated…
A: Genomic deoxyribonucleic acid (abbreviated as gDNA) represents chromosomal DNA. This DNA is in…
Q: epinephrine and noradrenaline related?
A: Epinephrine and Noradrenaline:Epinephrine is also known as Adrenaline.Noradrenaline is also known…
Q: Assume that the complete combustion of one mole of fructose, a monosaccharide, to carbon dioxide and…
A: ∆G°' = -2810 kJ/mol∆G°'compound x = -38.1 kJ/mol Moles =?
Q: Synthesis of the activated form of acetate (acetyl-CoA) is carried out in an ATP-dependent process.…
A: The nucleotide coenzyme adenosine triphosphate (ATP) is the most important form of chemical energy…
Q: Describe in one page why hydrogen, carbon, nitrogen, and oxygen can be considered the most important…
A: A living cell is the basic unit of life. It is capable of independent existence (as is the case of…
Q: Cold-blooded animals modulate the fatty acid composition of their membranes as a function of…
A: Answer :- Animals classified as cold-blooded, or ectotherms, depend on the outside temperature to…
Q: Draw the structure of the peptide DTLH, showing the backbone and side-chain atoms, at its…
A: There are four classes of biological macromolecules - proteins, nucleic acids, carbohydrates and…
Q: The Michaelis-Menten equation is often used to describe the kinetic characteristics of an…
A: Vmax is defined as the maximum reaction velocity at which all enzymes become saturated with…
Q: Which of the following is the a-anomer? H но H Но H2C H ОН H2C- нн ОН со 4 1 2 1 Submit 3 -OH Н ОН…
A: Alpha anomer
Q: You are a genetic analyst and you have a patient with inherited defects of glycolysis. Specifically,…
A: Hexokinase is an enzyme that catalyzes the rate-limiting first step of glycolysis.The…
Q: We did an experiment about carbohydrate chemistry and the prof did not elaborate on the details. She…
A: There are four types of biological macromolecules- nucleic acid, proteins, lipids and…
Q: How many oxygen atoms are reduced from each nadh and fadh
A: By the end of citric acid cycle most of the energy has been converted into high energy electrons in…
Q: A protein has binding affinity for its ligand of KA = 2 x 105 1/M at pH 5.0 and room temperature. a.…
A: Kd is the dissociation constant for a protein-ligand complex that measures the affinity with which a…
Q: What type of spatula should you use for corrosive ingredients?
A: The objective of the question is to identify the appropriate type of spatula that should be used…
Q: You begin to study enzyme Z, which catalyzes a simple reversible reaction that interconverts…
A: S to P conversion is said to have a of -6 kJ/mol. So, let's give 'S' a free energy (G) value of 0…
Q: Carbonic anhydrase of erythrocytes (M, 30,000) has one of the highest turnover numbers known. It…
A: The value of Kcat represents the catalytic efficiency of an enzyme. It is also known as the turnover…
Q: Would you expect any of the side chains in the peptide above to undergo hydrolysis? Select all that…
A: Hydrolysis is the cleavage of covalent bond by adding elements of water to it. A peptide is a short…
Q: For a reaction that proceeds spontaneously from reactants to products, the AG is O less than 0 00 O…
A: Gibbs Free Energy is a thermodynamic function that not only is related to spontaneity but also deals…
Q: Which of the following are features of facilitated diffusion? There may be more than one correct…
A: Biological membranes are structures that surround the cell or organelle and act as barriers. An…
Q: Disulfide bonds have been shown to stabilize proteins (i.e., make them less likely to unfold).…
A: Protein folding is driven by chemical and physical constraints. As a polypeptide chain folds into a…
Q: Consider the Haworth projections of B-L-galactose and B-L-glucose shown here. ОН ОН CH OH ОН ОН…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula:…
Q: 8H17NO2 is heated, and a condensation reaction occurs. A new molecule containing one peptide bond is…
A: The question is related to the skeletal structure of the peptide bond.The peptide bond is -C(O)-NH-…
Step by step
Solved in 3 steps
- Treatment of a polypeptide by 2-mercaptoethanol yields two polypeptides that have the following amino acid sequences: Ala-Phe-Cys-Met-Tyr-Cys-Leu-Trp-Cys-Asn Val-Cys-Trp-Val-Ile-Phe-Gly-Cys-Lys Chymotrypsin-catalyzed hydrolysis of the intact polypeptide yields polypeptide fragments with the following amino acid compositions: (Ala, Phe) (Asn, Cys2, Met,Tyr) (Cys, Gly, Lys) (Cys2, Leu,Trp2,Val) (Ile, Phe,Val) Indicate the positions of the disulfide bonds in the original polypeptide. I don't understand how the order of amino acids in Step 2 was arranged. Please explain. Thank you.Suggest a reasonable strategy for the specific phosphorylation of the5’ –OH group of a nucleoside.You are presented with Cytidine 5' triphosphate and Thymidine 5' triphosphate. Draw and upload to Efundi these phosphorylated structures as they would be connected in a polinucleotide in the order CpT / Show the individual phosphorylated structures first then show how they combine to form the polynuleotide. Show at any one of these structures where the glycosidic bond occurs
- Treatment of a polypeptide by 2-mercaptoethanol yields two polypeptides that have the following amino acid sequences: Ala-Phe-Cys-Met-Tyr-Cys-Leu-Trp-Cys-Asn Val-Cys-Trp-Val-Ile-Phe-Gly-Cys-Lys Chymotrypsin-catalyzed hydrolysis of the intact polypeptide yields polypeptide fragments with the following amino acid compositions: (Ala, Phe) (Asn, Cys2, Met,Tyr) (Cys, Gly, Lys) (Cys2, Leu,Trp2,Val) (Ile, Phe,Val) Indicate the positions of the disulfide bonds in the original polypeptide.Allosteric Regulation of Ribonucleotide Reductase by ATP and Deoxynucleotides Describe the underlying rationale for the regulatory effects exerted on ribonucleotide reductase by ATP, dATP, dTTP, and dGTP.Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stop
- In pyrimidine nucleosides the anti conformation predominates because of steric interactions with pentose. Do thepurine nucleosides have similar interactions?Protease enzymes cleave proteins by hydrolyzing peptide bonds. The strategy for each type of metalloprotease begins with generating a nucleophile that attacks the peptide bond that attacks the peptide carbonyl group. O Macmillan Learning On the basis of the information provided in the figure, show the next step in the mechanism for peptide-bond cleavage by a metalloprotease. Metalloproteases H R₁ HN Zn Enz 2+ R₂ Draw curved arrows on the pre-drawn structures to show the metalloprotease mechanism. If you need to reset the structures, click More followed by Reset Drawing. Select Draw Templates Groups More B - H Enz H H с R1 | : HN O | Zn 2+ B R2 N Zn EraseWhy is ti advantageous for a cell to expend metabolic energy to polymerize gulucose molecule.?
- The following amino acids that are often found inside globulin molecules are () A, Tyr B, Phe C, Asn D, Glu True of false 1. In the de novo synthesis of purine nucleotides and pyrimidine nucleotides, base rings are first synthesized and then corresponding nucleotides are formed with phosphoribose. () 2. Transcription is the process of transferring genetic information from DNA to RNA. DNA is synthesized under the catalysis of RNA polymerase, and the direction of synthesis is from the 5 'end to the 3' end. () 3. The change of protein conformation is caused by the breaking of covalent bonds within the molecule. () 4. In very high and very low pH solutions, amino acids exist mainly in non-ionic form. () 5. The active center of an enzyme usually consists of several amino acid residues adjacent to each other in the primary structure. ()E Threonine 6. You have identified some intermediates in threonine synthesis: A, B, C, D and E. You grow a few of your mutants in the presence of these different intermediates to determine the order in which the gene products act. Below are your results. A (+) means growth and a (-) means no growth. Given these data, draw the best possible pathway for the synthesis of threonine. The diagram should use arrows to indicate one intermediate being changed to another intermediate. Indicate which gene produces the product responsible for the conversion by listing the mutant in that gene above the arrow. Mt1 Mt2 Mt4 Mt7E. coli ribonuclease H1 is an enzyme that catalyzes the hydrolysis of phosphodiester bonds in RNA. Its proposed mechanism involves a 'carboxylate relay,' as shown below. His124 Asp70 || -HN-CH-C -HN-CH-C- CH2 CH2 c=0 RNA substrate HN H. H. (1) Fill the blanks. In the reaction scheme above, His124 acts as a ( ). The purpose of this relay system is to deprotonate the water molecule (II) so that it becomes a better ( :0