7( what is the diagram depictinA) transcription and translation returnB. DNA replicationC -DNA replication transcription and translationD-transcriptionE- translation 3 ptVhat is this diagram depicting?1Direction ofRNA polymeraseamino acidlarge subunof ribosomeribosomepolypeptide chains2.

Gene is a hereditary units that are present on the Chromosome. It contain genetic instructions . DNA…

Answered: what is the diagram depictin A)…

what is the diagram depictin A) transcription and translation return B. DNA replication C -DNA replication transcription and translation D-transcription E- translation

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 22P

See similar textbooks

Related questions

Q: 14. During DNA replication, an adenine base is base paired with a cytosine. This is an example of a.…

A: According to Chargaff's rule, the basis of base pairs in the DNA double helix: A always pairs with…

Q: 9 The table opposite shows the standard riplet codes for the 20 amino acids involved in protein…

A: Transcription is the process in which the DNA strand which codes for a protein and e converted to…

Q: The base sequence on one strand of DNA is ATGTCTATA(i) Give the base sequence of its complementary…

A: The deoxyribonucleic acid is the genetic material that is passed from one generation to another…

Q: What process in protein synthesis that is NOT affected by a silent mutation? Select one: a. Synapsis…

A: Each protein molecule has hundreds, if not thousands, of amino acids that are linked together in a…

Q: transcribed RNA

A: Transcription is the process of copying a segment of DNA into RNA. Only one of the two DNA strands…

Q: 1. For cach of the items below, give a brief description (indicate function for enzymes) and…

A: All the above-mentioned enzymes are part of the central dogma of the cell. It consists of three…

Q: 8. Which serves as the template for the assembly of amino acids during protein synthesis? * A. DNA…

A: As per our guideline, I gave you the first 3 answer below. Please post rest of the question…

Q: REPLICATION TRANSCRIPTION a) Origin of Replication a) Origin of Replication b) Promoter TRANSLATION…

A: For replication, origin of replication is important where replication machinery will form and start…

Q: . Which of the following statements about the flow of genetic information is correct? A. Translation…

A: Genes are the basic hereditary molecules that carry hereditary information in them. They are present…

Q: outline 4 differences between the leading and lagging strand of DNA replication

A: Leading strand. 1.It is a replicated strand of DNA which grows continuously without any gap 2. It…

Q: . The table opposite shows the standard (coding strand) DNA inlet codes for the 20 amino acids…

A: Given , the coding strand is 5'-CATCCAAATTGTTGCCCG-3' THE TEMPLATE STRAND WILL BE ,…

Q: 10. In the diagram below, Transcribe the two new complementary strands of DNA. ,ΑTIGCCAAGT…

A: According to the question, we have seen a diagram, where we have to transcribe the two new…

Q: 7. Fill in the following table. Acid TRNA MRNAI DNA DNA amino sense anti-sense UGA UGA, Histidine…

A: Transcription: It is the process through which the enzyme RNA Polymerase transfers information from…

Q: 2. Refer to the protein phe-trp-tyr-cys-ala-met-leu, construct a DNA strand that can transcript an…

A: mRNA stands for messenger RNA which is a single stranded RNA molecule that is complementary to one…

Q: A slight change in a single amino acid in polypeptide chain results in Select one: a.…

A: Amino acids are the building blocks of proteins. A chain of amino acids which are linked by peptide…

Q: The following DNA strand is the CODING strand. What is the sequence of the RNA which is transcribed…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: For each DNA segment: [1] What is the sequence of the mRNA molecule synthesized from each DNA…

A: Gene expression is the process by which the instructions in the DNA is converted into a functional…

Q: In the diagram below (Figure 22), fill in the terms in the appropriate places indicated by a letter.…

A: This represents central dogma of molecular biology. It shows the flow of genetic information from…

Q: Choose one among the three: DNA replication, transcription, and translation and then discuss its…

A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…

Q: ure 1 above shows that remdesivir “mimics” an important component of RNA replication. Which…

A: A broad-spectrum antiviral drug that is injected intravenously is called Remdesivir. This medication…

Q: 2. Identify the following structures when given images such as the ones below: ● process of…

A: Introduction The cell is the basic structural and functional unit of life present in all living…

Q: DNA is directly involved as a template in the following processes, except _________. a. mutation b.…

A: Deoxyribonucleic acid, or DNA. It includes units known as nucleotides, which are biological building…

Q: . Rifampin binds to bacterial RNA polymerase. b. Streptomycin binds bacterial ribosomes, disabling…

A: The answer of the following question is given below.

Q: DNA TRANSCRIPTION TRANSLATION REPLICATION (D) DNA template (B] 3'-5' (C) MRNA (E) New (F) Name of…

A: Transcription is the process of synthesizing an RNA by the action of a DNA dependent RNA Polymerase.…

Q: 1. Write the complementary base sequence for the matching strand in the following DNA section:…

A: DNA or Deoxyribonucleic acid, is a complex molecule that contains all the genetic information which…

Q: 1.What is corresponding amino acid chain of the mRNA sequence AUG-CGU-UCU-GCU GGU-UAG? 2. What are…

A: Eukaryotes and Prokaryotes store genetic information in form of DNA and RNA. Some of them have…

Q: 6. Describe transcription, include the following terms: mRNA, RNA polymerase, promoter, template…

A: "Transcription" and "Translation" are two important processes that take place inside the cell for…

Q: Table 8.2: Transcription and translation of the first 7 codons in the B-globin chain of hemoglobin.…

A: Change in the DNA sequence can causes alternation of the amino acid sequence. This can causes an…

Q: Which of the following is not depicted in the diagram?* O Okazaki fragment O Replication fork O…

A: The diagram is showing ongoing Replication. Replication is the process by which double stranded DNA…

Q: What is the role of ribosomes in protein synthesis? * A. they carry proteins to the site of action…

A: Protein synthesis takes place in the cytoplasm. The mRNA is read in the pair of three bases at a…

Q: Select ALL of the following that apply to translation. Select one or more: a. occurs in the nucleus…

A: The translation is a process that is part of the central dogma that follows the process of…

Q: 2. Predict the following sequences of base in the DNA strands complementary to the single RNA…

A: A molecule that consists of a long chain of repeating units called nucleotides. The sequence of the…

Q: Which process in protein synthesis is most affected by a silent mutation? Select one: a. Replication…

A: Silent mutation are essentially base replacements that outcome in no difference in the amino acid or…

Q: tabulate 2 differences between DNA replication, the process of trancsription and translation…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: 9. What is the purpose of the following? a) spliceosomes b) RNA polymerase c) Protein release…

A: The central dogma of molecular biology involves the processes of transcription and translation that…

Q: The entire complex that forms to initiate DNA replication is known as

A: The replisome is the large protein complex formed before the DNA replication process. It contains…

Q: 1. For each of the items below, give a brief description (indicate function for enzymes) and…

A: The process of replication and transcription are catalysed by different Enzymes and proteins. The…

Q: Match Column A with Column B. pulls a portion of the DNA strands apart from each A. 3rd event other,…

A: The process of transcribing a piece of DNA into RNA is known as transcription. Messenger RNA is made…

Q: radiodurans can survive strong ionizing radiation (gamma radiation). What DNA repair process? a.…

A: Gamma radiation break DNA strand and create oxidative DNA damage. To repair this need homologous…

Q: Mutation occurs in which part of the central dogma process? a. replication b. transcription c.…

A: Mutation is a sudden change or alteration in the sequence of DNA that might or might not produce an…

Q: 1. For each of the items below, give a brief description (indicate function for enzymes) and…

Q: Translate a mRNA sequence into a protein sequence using the genetic code. 2) write the…

Q: One strand of DNA has the base sequence as shown below. Complete the transcription and translation…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: 4. Which MRNA sequence complements the DNA sequence below? (LS1- 1) * A C SUP Sequence A O Sequence…

A: The DNA molecule in the cell stores the genetic information of the organism. But this information by…

Q: . Describe and list the steps involved in DNA replication. 2.

A: DNA is a molecule made up of two polynucleotide chains wrapped around each other to form a…

Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…

A: The central dogma The central dogma is the process involving three major events in cells these are…

Q: .If the template DNA sequence is 3' - CCC - ATA - GAG - AAA - 5' , then what is the corresponding…

A: DNA replication is a process in which new copies of DNA is made.The mode of DNA replication is…

Concept explainers

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.

Question

7( what is the diagram depictin A) transcription and translation return B. DNA replication C -DNA replication transcription and translation D-transcription E- translation

3 pt
Vhat is this diagram depicting?
1
Direction of
RNA polymerase
amino acid
large subun
of ribosome
ribosome
polypeptide chains
2.

Definition Definition Mechanism by which deoxyribonucleic acid (DNA) is capable of producing an exact copy of itself. DNA molecules utilize a semiconservative method for replication. DNA replication is the most essential part of biological inheritance and is crucial for cell division during growth and repair of damaged tissues.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

20:201 Foundations Cell Molec 48. The first 17 amino acyl residues in human preproinsulin are H₂N-MALWMRLLPLLALLALW-COOH and the encoding nucleotide triplets ("codons") in DNA are 5'-ATG GCC CTG TGG ATG CGC CTC CTG CCC CTG CTG GCG CTG CTG GCC CTC TGG-3'. Are these molecules written according to their colinearity? A) No. Colinearity is written C-N and 3'-5' for proteins and nucleic acids, respectively. Yes. Colinearity is written N→C and 5'-3' for proteins and nucleic acids, respectively. No. Colinearity is written C-N and 5'-3' for proteins and nucleic acids, respectively. D) There is no such a thing as colinearity. red by ribozymas
Which THREE statements are true about targetting proteins to the nudieus? Aln the cytoplasm, a protein with an appropriate nuclear localization signal (NLS)is brund by a compna sd moint Importins a and B and CAS are degraded in the nucieus The nuclear localization sequence usually contains around 20 ameno aoids The nuclear localization sequence contains severai consecutive basic (Arg or Lysi me The nuclear localization sequence is ocated almost anywhere in protein amino aad sequerce The nuclear localization sequence is emoved after targeting to the nucleus
Match the primary sequence to its characteristics/function/fate v N-signal 1. mostly hydrophobic, interacts with SRP, cut off v signal-anchor 2. hydrophobic, interacts with SRP and translocon, becomes transmembrane helix v stop-anchor 3. found at carboxyl terminus of ER resident proteins, interaction with its receptor directs retrieval from Golgi v nuclear localization sequence 4. hydrophobic, interacts with translocon, becomes transmembrane helix v KDEL 5. basic, interacts with importin-alpha
answer all subpart to upvote because vert short question otherwise dislike Viruses that infect bacteria (bacteriophage) sometimes encode a lysozyme gene in their genome. The gene gets inserted into the bacterial genome and gets expressed in the same way that bacterial genes get expressed. A) What location in the bacterial cell would the gene get transcribed into mRNA? (1 sentence max) B) What protein complex would perform the transcription to produce the mRNA? (1 sentence max) C) Where in the bacterial cell would the gene get translated? (1 sentence max) D) What protein complex would perform the translation to produce the protein? (1 sentence max)
Name each of the processes pictured: -RNA 5' TCAC CÁCTCAT 3' TACCACCTA 3' UUCAC CACUCAU U 5' DŇA RNA polymerase Primary RNA transcript Exon 1 Intron Exon 2 Intron Exon 3 Spliced RNA 000 Exon 1 Exon 2 Exon 3 AAAAAAA polypeptide chain Met Phe Arg P E UAC AAA GCU AUGUUUCGA Ribosome There are possible nucleotide "triplets" or
Ribosome-targeting antibiotics x 8 Tetracycline Antibiotics: Mode x D (3) The Nurse- du/d21/Ims/quizzing/user/attempt/quiz_start_frame_auto.d21?ou=5003190&isprv3&drc%3D0&qi%3D4975665&cfe self quiz ngel Kenkpen: Attempt 1 For each description, state if the gene expression will increase (1), decrease (2) or remain the same (3). Binding of the CAP protein to the lac operon promoter An enhancer sequence without at activator bound Binding of a repressor protein to an operator Increased glucose at the lac operon chromatin condensation Increased number of ribosomes on a single MRNA transcript (polyribosome) Binding of an activator
Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?
GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
Give me nucleotide sequence with pairing. Like this ATC TCA TGA GCC TAG AGT ACT. CGG
A solution of pure αβ-tubulin dimers is thought tonucleate microtubules by forming a linear protofilamentabout seven dimers in length. At that point, the probabili-ties that the next αβ-dimer will bind laterally or to the endof the protofilament are about equal. The critical eventfor microtubule formation is thought to be the first lateralassociation (Figure Q16–2). How does lateral associationpromote the subsequent rapid formation of a microtu-bule?
E D ot OH ON O Replication R SORO Transcription ORNA processing Translation Gene expression 657 F Q Search % T G LOCLE Y F7 & 87 F8 U 99+ 8 F9 53879 10 F10 O 2 H J K L CV BN MO < F12
A chromosome contains many different genes that are transcribed into different ___ . a. proteins b. polypeptides c. RNAs d. a and b