Using the DNA figure below to identify structures of the following letters: A= B= C= D= E= F: Circle a nucleotide for each backbone strand A G a (4::( B A G (: G ( E
Q: brown red Jorange
A: Dna is a double helical structure consisting of a deoxyribose sugar, phosphate and nitrogenous…
Q: Using your own words and including the phrases “5' to 3" and "3' to 5" explain how a double helix of…
A: The genetic material of many species, including humans, is DNA, or deoxyribonucleic acid. The…
Q: Draw a double-stranded DNA molecule (using different colors for each) model should clearly represent…
A: A G T A C C G G G C A A the sequence of DNA
Q: Identify three discoveries listed above that were essential in determining the structure of the DNA…
A: The structure of DNA was given by two scientists known as James Watson and Francisco crick.
Q: draw a picture of a SINGLE strand of DNA (a polynucleotide) composed of 9 (nine) nucleotides of your…
A: Nucleic acids are made up of chains of many repeating units called nucleotides. The DNA molecule…
Q: Deoxyribonucleic Acid (DNA) and Ribonucleic Acid are the two main nucleic acids. In all living…
A: Nitrogenous bases are heterocyclic and water insoluble molecules. These nitrogenous bases are two…
Q: Bonding between complementary bases Weak hydrogen bonds form between complementary base pairs. The…
A: DNA (deoxyribonucleic acid) is the genetic material of almost all living organisms. It is a double…
Q: One DNA chain of a DNA double helix contains 18% A, 35% T, 28% C and 21% G. What is the composition…
A: DNA is a genetic material present in most of living organism and it is composed of nucleotides.…
Q: Which of the following statements about polynucleotide formation is correct? As a polymer, DNA is…
A: given are some statements regarding polynucleotide formation and the correct among them is given…
Q: A researcher is studying the effect of pH on a nucleic acid assuming it is DNA. She adds the nucleic…
A: DNA it stable during certain pH exposure in a solution.
Q: H. HD N. A N- H- H. 0=P-0- CH2 H. H. H. OH) H B. Where would this nucleotide hydrogen-bond to its…
A: Each nucleotide is a monomer of nucleic acid such as RNA and DNA. The RNA and DNA differs from each…
Q: Describe the structure and complementary base pairing of DNA.
A: DNA is made up of molecules known as nucleotides.Each nucleotides contains a Phosphate group Sugar…
Q: Given the following strand of DNA: 5' CATAGCCTTA 3' Which of the following sequences is the…
A: DNA and RNA are nucleic acids present in organisms. DNA is the deoxyribose nucleic acid whereas RNA…
Q: explain how the biochemical structure of DNA allows it to function as the genetic materia
A: Introduction: Deoxyribonucleic acid, or DNA, is a molecule that provides the genetic instructions…
Q: Draw the following strands of DNA 5’ C-A-T 3’ as well as the complementary base pairing strand…
A: Two strands of DNA twist around one another to form a double helix DNA and both are in anti-parallel…
Q: Describe the three important of the protein DnaA.
A: In this configuration, the DNA(Deoxyribonucleic acid) duplex hinders replication. Only when both…
Q: Match the relevant components of the DNA molecule below using the options provided. Record your…
A: There are few important point that should kept in mind: Nucleic acid are of two types:…
Q: . Other polar molecules include nucleic acids and some proteins. Look at the DNA sketch provided and…
A: Since we only answer 1 question in case of multiple question, we’ll answer the first question as the…
Q: Hydrogen bonds are important in DNA replication and transcription. They are relatively weak…
A: Hydrogen bonds are a type of attractive interaction between an electronegative atom and a hydrogen…
Q: Using the Figure below identify: What is the significance of hydrogen bonds in double helix of DN…
A: Deoxyribonucleic acid, or DNA, is a molecule that holds the information that allows an organism to…
Q: Match the label on the left with the correct structure number in the DNA molecule in the image…
A: The given structure is of a alpha helix DNA. The DNA is composed of nucleotides. Nucleotide - The…
Q: There are four different type of nucleic acids which may be strung together to make DNA. These four…
A: There are four different biomolecules are present in nature, they are carbohydrates, protein, lipid,…
Q: C-A-G-T-T-A-A-G-G-C-T-C-C-T-A-G-G-T-T-A 5' i. What would be the first 5 bases at the 3' end of the…
A: 3' C-A-G-T-T-A-A-G-G-C-T-C-C-T-A-G-G-T-T-A 5' Complementary strand- 5'- CTCAATTCCGAGGATCCAAT-3' i)…
Q: DNA structure depends on base pairing of its four nucleotides, A, C, T, and G. Nucleotide A pairs…
A: The monomeric units of nucleic acids are called nucleotides. DNA is a polynucleotide which contains…
Q: shows the structure of a DNA molecule. guanine E A B D Name A, B, C, D, and E. (ii) Make a quick…
A: They are double-stranded helix structure which is a polymer of four bases. Both the strands are…
Q: The base content of a particular DNA molecule is 36% thymine. What is the percentage of each of the…
A: DNA consists of the bases adenine, guanine, thymine, and cytosine. These 4 bases together account to…
Q: Moving from 3’ to 5’ along the sugar phosphate backbone of a single strand of nucleic acid, the…
A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…
Q: How many times wider is a 30 nm fiber than a DNA double helix? Show your work.
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…
Q: The number of hydrogen bonds between the two strands of a ds oligonucleotide given the following…
A:
Q: List the DNA bases that will complementary base pair with the following sequence: A-G-C-T-A-C-G
A: There are four nitrogenous base pairs in DNA Adenine Guanine Cytosine Thymine
Q: Using your own words and including the phrases “5’ to 3’” and “3’ to 5’” explain how a double helix…
A: DNA or deoxyribonucleic acid is the genetic material of many organisms including humans. The two…
Q: Which of the following correctly shows complementary base pairs in DNA and RNA? a.DNA= A:T & G:C b.…
A: Both ribonucleic acid (RNA) and deoxyribonucleic acid (DNA) are composed of nucleotides. And a…
Q: In a sample solution given to be analyzed; CATAGCTTTGTTAAA (DNA nucleotide chain). Show the 5 'and…
A: DNA or deoxyribonucleotide chain is a double helical structure, containing nucleotide monomers,…
Q: Association of two or more polypeptides(ex. tetramer quaternary structure primary structure tertiary…
A: Proteins are unbranched polymers constructed from 22 standard α-amino acids. They have four levels…
Q: draw a strand of DNA 4 nucleotides long (4 nucleotides on each side). Label the 5’ ends, the 3’…
A: The double-stranded DNA is made up of two strands that run in opposite directions and made up of…
Q: (You can answer part (a) and part (c) together if it is more convenient to do so). DRAW condensed…
A: Biochemistry is a branch of science that deals with the study of chemical processes related to the…
Q: You are supplied with the following information about a DNA molecule: The molecular weight of a…
A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…
Q: A strand of nucleic acid is defined by its sequence of nucleotides: A, C, T, and G. How many…
A: Nucleic acids are large biomolecules or biopolymers which is vital for each known form of life. The…
Q: When comparing the structures of RNA and DNA, which of the following statements is TRUE? OA Only RNA…
A: DNA and RNA are the nucleic acid. They are polymer of nucleotide, also called as polynucleotide. A…
Q: STRUCTURE OF DNA Phosphate Nitrogenous Base Pentose Sugar Referring to the illustration above, the…
A: DNA is the geentic material. It stands for deoxyribonucleic acid. It is present in the nucleus,…
Q: base composition which contains 20% of the base adenine (A). (a) How many phosphor atoms are…
A: Hello. Since your question has multiple sub-parts, we will solve the first three sub-parts for you.…
Q: Using the DNA figure below to identify structures of the following letters: A= B= C= D= E= F: Circle…
A: DNA molecule is a polymer of nucleotides and each nucleotide has three main components that are…
Q: The following are the four bases found in DNA. Which base pair can form three hydrogen bonds? * NH2…
A: The nucleic acids (DNA and RNA) are made up of nucleotides. Each nucleotide is composed of one…
Q: Seatwork: Give the name of the followingand identify Nucleotide or nucleoside Sugar 2 NH2 но он NH2…
A: All living organisms are made up of cells, which are the most basic unit of life. They are…
Q: (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a…
A: In the above figure the sequences are arranged on the basis of complimentarity. Let's assume red…
Q: A B-DNA molecule has 1 million nucleotide pairs. How many complete turns of the helix are there in…
A: Majority of DNA present in the cytoplasm of living cells exist in double helical structure as…
Q: In DNA polymer, one nucleotide joins with its neighboring nucleotide at 5' carbon. is it true or…
A: DNA is a polymer. It is a polymer. Nucleotides are the monomer units of DNA. A 5-carbon sugar…
Q: The shape of a and sugar groups on the sides, and nitrogenous bases (A, T, G, C) in the middle.…
A: Hi! Thanks for your question. But as you have posted multiple questions, I am answering the first…
Q: The nucleotide sequence of one DNA strand of a DNA double helix is 5’-GGATTTTTGTCCACAATCA-3’.What is…
A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 4 images
- For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandWrite out the DNA sequence using the following instructions: This is a double stranded DNA hydrogen bonding with each other following the principle of complementary base-pairing Each strand contains ten nucleotides Each strand contains all four different types of nucleotides You should indicate clearly the directionality of each strand in your answer You do not need to draw the full nucleotide structure. Use the one-letter code (A, T, G, C, or U) to represent each nucleotideIn a sample solution given to be analyzed;CATAGCTTTGTTAAA (DNA nucleotide chain). Show the 5 'and 3' ends by writing in triplet (codon) form. Find the number of Hydrogen bonds in the double helix DNA strand at the beginning.
- Draw the following trinucleotide: pGAUWhat is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence.Identify the base shown below. Drag the correct base to the rectangle in the image O I HN H₂N Adenine Cytosine N N IZ 5 methyl cytosine H Guanine Thymine
- DNA structure depends on base pairing of its four nucleotides, A, C, T, and G. Nucleotide A pairs with T, and nucleotide C pairs with G. This forms a four-letter DNA “alphabet." Because DNA codes for amino acids in sets of three nucleotides, there are 4 cubed (4'), or 64, possible combinations, coding for 20 different amino acids. What is the best explanation for why there is no selective advantage for DNA to have five nucleotides (e.g., A, C, T, G, and E) with C pairing with either G or functionally equivalent E? It would be impossible to form the DNA molecule, because it must have an equal number of Cs and Gs. Because G and E have the same role, there would still be four functional letters of the alphabet. Replication would be inaccurate because sometimes C would bond with G and sometimes C would bond with E. There would be a five-letter alphabet with 125 combinations, which is too numerous. It is impossible because there are not five known nucleotides in the cell.Identify the base shown below. Drag the correct base to the rectangle in the image O HN H₂N Adenine Cytosine N N N ZI 5 methyl cytosine H Guanine ThymineTranslate this nucleotide sequence into an amino acid sequence. Gene Sequence (5'-to-3'):…
- Place an asterisks (*) next to the 3' carbon atoms in the polynucleotide shown. -O CH₂ HOHDH Guanine -O-CH₂ H H H Thymine =P-O-CH₂ H OH Answer Bank H H CytosineThere is a chemically synthesized DNA oligonucleotide is 5’–AUCG–3’. Pleasedraw the all-atom structure of this RNA strand, including that of the phosphategroup, the pentose (ribose), and the base for each nucleotide. The structure is inthe 5’→3’ directionWrite the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA TGTGCGCGCGGGGCG