Q: 10. Lo 12. 14 15. 16. 17, to
A: Inflorescence consit of the complete flower head containing stems, bracts, stalks, and flowers and…
Q: (e) Fill the folowing (i) Li(3, 6)+? → Be(4,7) ± n(0, 1) (ii) Br(35, 79) ± H(1,2) →? + 2n(0, 1)
A: Subatomic particles are composite particles which are smaller than atoms and includes electrons,…
Q: 1-Cheese Composition Data in Table (1) clearly showed that pH of all cheese decreased significantly…
A: Domiati cheese is Egypt's most beloved soft cheese. It may be eaten either fresh or pickled. Heart…
Q: Use the choi 5. Shown bel this, detern 72.72 Scae sizeu Eningenver Actualsize=: Use the cho
A: Eubacteria /True Bacteria --Single cell bacteria , prokaryotic microorganisms which are found in…
Q: of vifomin c Woite atleast thrpe Yole in oUr body.
A: Vitamin C is also known as ascorbic acid and its active form is ascorbic acid.
Q: TM Ps. au OX AMC S E CC SXT ΤΕ .25.07 CIP C CF P
A: The effectiveness of an antibacterial treatment on a surface or product can be quickly assessed…
Q: Which of the following CHÍNH, CH HO CHÁNH, CH₂OH I CH H₂N both a and b neither a nor b CHÍNH
A: Stereochemistry is also known as the subdiscipline of the chemistry. Stereochemistry involves the…
Q: if fish ina certain lake are reported to contain 4.0 ppm by weight DDT,(a) what percentage of the…
A: Parts per million is a way to measure concentration, it refers when a part is some substance is…
Q: What the high value of BOD indicates?
A: BOD stands for biochemical oxygen demand and as the term suggests it is the amount of oxygen…
Q: What is the most dangerous STI
A: STI is the abbreviated form for sexually transmitted infections, these are infection which are…
Q: Explain the term GFAP
A: A cell is the basic structural and functional key of life. A cell has multiple organelles that carry…
Q: 1. If p .25, then q must equal
A: Hardy Weinberg principle states that the allelic frequency remains constant through generations and…
Q: Identify each vein in Figure and write its name next to the number.
A: Blood vessels are structures that delivers blood to all the tissues of the body. It is of two major…
Q: Glu = 102 mg/dL Lac = 0.87 mEq/L %3D Hb = 10.56 g/dL %3! SO2 = 90 % p50 = 32.5 mmHg FiO2 = 8 LPM 02…
A: ABG values Interpretation probable cause intervention glucose 102 mg /dl lactic acid 0.87meq/l…
Q: Which element is oxidized and which is reduced in the following reactions?
A: The oxidation number is the count of electrons that atoms in a molecule can share, lose or gain…
Q: A 0% В 10% C 10% 17.5917.66 8.75 10.40 11.24 12.10 D 10% 10% 10.71 10.57 18.05 15.60
A: Tonicity defines the ability of a solution to change/alter the volume of its surrounding cell by…
Q: What is v/Vmas ratio when [S] = 4km?
A: In biochemistry, Michaelis–Menten energy is a standout amongst other known models of catalyst…
Q: Dahedlineis the lir endef the yealy anenes 42 44 44 190 2000 201 btny k
A: The slope of a straight line describes the direction and steepness of the line. For a straight line…
Q: Tropomyosin, at 93 kd, sediments at 2.6S, whereasthe 65-kd protein, hemoglobin, sediments at 4.3S.…
A: Introduction Tropomyosin is a 40-nanometer long rod-shaped molecule. Along the actin filaments, two…
Q: It AH Fus Lon is 100 kcal Imol + AH vap 200 Kcal Imoi. What is DH sublimation? IS
A: Given : Delta Hvaporization : 200 kcal/mol Delta HFusion : 100 kcal/mol
Q: Ndel 183 Aatil 2617 Sspl 2501 Ehel 235 Pdml 2204 Bogl 2215 Scal 217 146/ 230 MCS lacz 2486 PUC18…
A: INTRODUCTION Screening techniques It inclued Blue white assay, Agarose gel electrophoresis, replica…
Q: O0OO 000 Letter "e" at 4X Letter "e" at 40X Onion Root at 40X Spider at 4X Compact Bone at 10X Blood…
A: Cells are too small to be seen through naked eyes. They can be studied only through an instrument…
Q: 4. G's go with A's T's C's G's
A: Nucleic acid such as RNA or DNA is composed of several nucleotides joined end to end A nucleotide is…
Q: 5' T A A G A G A 3' A A A AT HA
A: The complementary base pairing according to Watson-Crick model of B-DNA is as follows: 1. Adenine…
Q: Name process T. Namakan proses T. State what happens at U. Nyatakan apa yang berlaku pada U. -…
A: Megasporogenesis is the process of producing megaspores out of a megasporocyte, which is a cell that…
Q: abel the following on the graph: C 1000 10000 Percent Effect
A: Partial agonists are ligands that bind to the agonist recognition site but produce a weaker response…
Q: The adult RDA of riboflavin is 1.3 mg. If one glass (100 mL) of apple juice contains 0.014 mg of…
A: Riboflavin or vitamin B2 is one of the members of the vitamin B-complex. It is required for cellular…
Q: Plasma in blood has percent water ----- O 1.55 O 2.45 O 3.90 O 4. 10
A: The blood is composed of plasma and RBC (red blood cells). About 55% of the blood is plasma while…
Q: 1) CaHe+O2 → _CO2 +_ H20 2) Al+ FesN2 →AIN + Fe 3) Na + Ch NaCI 4) H2O2 > H20 + O2
A: The symbolic representation of any chemical reaction is said to be a chemical equation. In a…
Q: he of a hucleić áčid is the nitrogen bases. True
A: Nucleic acid is a biomolecule that was composed of a nitrogenous base, a pentose sugar, and a…
Q: At room temperature, if AH = -10 and AS = 100 %3D Then AG is O a) zero O b) spontaneous O c)…
A: Gibbs free energy refers to the chemical energy associated with the reaction that is used to do…
Q: Define the following terms:a. chylomicronb. VLDLc. IDLd. LDLe. HDL
A: Lipoproteins are complex molecules that bundle cholesterol for transport. The lipids, along with…
Q: Compare between Rest (R) and Taut (T) Hb (Nature)
A: Blood is the extracellular fluid that flows inside the blood vessels. One of the main functions of…
Q: What does the following values represent 100/1.250 0 B A 160/0.17
A: A clear microscope or amplifying glass (focal point) gives an picture of the object on which it is…
Q: Under normal conditions, the O(2)ER is about A. 10 percent B. 15 percent C. 20 percent D. 25 percent
A: The oxygen extraction ratio (O2 ER) is the proportion of the oxygen separated from the peripheral…
Q: 007- Iroforms 7 7 actate dehyong.enome (L)H) ne (LDH) present in BI00d.
A: Isoenzymes are physically distinct from of enzyme that catalyses same biochemical reactions.
Q: Restate Liebig’s Law of Minimum to include conditions/ factors in these present times. Explain your…
A: Hi! Since you have 2 questions, we will be answering the first one for you. If you want the second…
Q: We eat.. the dining room." O in on O under at
A: We use the knowledge of verb and adverb .
Q: My freezer broke,so I had to empty $500 of ruined food from the 390 liter freezer Now that my…
A: Volume of freezer- 390 L 1 mol of nitrogen = 22.4 L
Q: How would you prepare a 1:2000 dilution? I need help understanding , thank you
A: The question asks that how to prepare a 1:2000 dilution.
Q: Fill out the concept map. In the middle circle, describe a just law. For the outside circles…
A: We have to name any law and also have two explain the basic four purposes related to it.
Q: ANN/SUA 7 lig. 171 shows two microscopic structures that are adapted for absorption, one from an…
A: Root hairs looks out for food and nutrientsin the soil while villi obtains the nutrients readily in…
Q: Draw the table of texanomic category and explain with all components?
A: Taxanomy It is a branch of biologcal science that deals with classification of organisms on the…
Q: 1 tsp po bid #4 oz How many days will the medication last?
A: The medication, also called a pharmaceutical drug, is a chemical substance that causes biological…
Q: 1When you gargle water, add salt, add dishwashing liquid solution, and 2 drops of pineapple juice,…
A: The ingredients that are mentioned are used for the purpose of extraction of DNA . Process of…
Q: 1 tab qd Mon, Wed, Fri, Sun and 2 tab qd Tues, Thurs, Sat x 14 days How many tablets should be…
A: The specified amount of drug or medication that is taken at a time refers to the drug dose. Dosage…
Q: Where the fuel is used?
A: Any material that releases heat energy or power on burning is called fuel. A good fuel should be…
Q: 3.1 The no of Components present in the fellasng c)a soluton of common sall- cio Mg cogls) Mg cog…
A: Asked : Number of components in the following system
Please show all
4 crosses. Thank you
1) YYSSxyyss
2)YySSx yyss
3) yySs x yyss
4) YySs x yyss
Thanks
Trending now
This is a popular solution!
Step by step
Solved in 6 steps with 1 images
- A) With what disorder is BRC-ABL associated? B) What drug is used to treat this disorder?B BE -70 Membrane potential (mv) +35 A) A. B) B. C) C. D) D. E) E. C) D) D. C. D 2 Figure 37.1 30) In Figure 37.1, the period in which voltage-gated potassium channels are open and hyperpolarization has yet to occur is at label 3 A) A B) B C) C D) D Time (milliseconds) 31) In Figure 37.1, the membrane's permeability to sodium ions is at its maximum at label A) A. B) B. 4 32) In Figure 37.1, at what point in the graph are sodium channels closed (or closing) and potassiu channels opened? 33) In Figure 37.1, the neuronal membrane is at its resting potential at label A) A. B) B. C) C. D) D. E) EWhat does the word "deppresion" really mean?
- S Savwas Rea lize NGSS ommunity/classes/da298ebd9 c514500827f97e044ab6ee8/assignments/2c3a 98df8d654edaab97cc6399 5c23fd/content/1ccf1054-b803-361d-b16a-8b4 G saint mother teresa. A Sa int Report K Maddox Bry ant - gr. Vs-nhm Growth lan's father keeps bees, and lan spends time observing their behavior. He is especially interested in bee communication and has even seen the waggle dance. The waggle dance communicates the location of food to other bees in the hive. All honeybees know the waggle dance from birth. Choose the correct words to complete the sentences. The waggle dance is an example of a(n) Choose... behavior, because bees can perform it correctly the first time. Bees exhibit Choose... Choose... ovide food and protection for the hive's young. learned predatory courtship instinctiveHindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5' CCTAG - G 3' 5' AGAATTCTTACGCCGGACGTACCTAGGTTTAGTCGACTC CGCCGCCCCTAGGGTCATCA 3' 3' TCTTAAGAATGCGGCCTGCATGGATCCAAATCAGCTGAGGCGGCGGGGATCCCAGTAGT 5' Number of pieces of DNA , and blunt end fragment (s), and sticky end fragment(s)Please dont provide handwrittin solution.../.
- T с A G T TCT TCC TCA TCG CCT ccc CTA CCA CTG CCG ATT ACT ATC Ile ACC Thr TTC TTA TTG CTT CTC Phe Leu Leu ATA ATG Net GTT GTC GTA GTG с Val Ser Pro ACA ACG GCT GCC GCA GCG TAT TAC TAA TAG CAT CAC CAA CAG AAT AAC AAA AAG A Ala Tyr ✰✰✰ 2) Mutant E makes Met-His-Val-Arg His 1) Mutant D makes Met-His-Val-Gly-Asn-Thr G Cys TGA TGG Trp CGT CGC TGT TGC Gln GAT Asp GAC GAA Glu GAG Standard genetic code Asn 5'-ATGICACIGTAIGGT|AAC|ACTIGAGICCC|TGACC-3' 3'-TAC|CTG|CATICCG|TTG|TGA|CTC|GGG|ACTGG-5' Met His Val Gly Asn Thr Glu Pro STOP Lys CGA CGG AGT AGC AGA AGG GGT GGC GGA GGG Arg FURG TUAO HUKO HLAG Ser The DNA segment below encodes the short peptide of 8 amino acids. Mutant strains produce the altered proteins shown below. Arg Using the genetic code table provided, a) describe the exact single base pair alteration that must have occurred in the DNA to give rise to each mutant protein, b) name the kind of mutation it is, and c) show how it leads to the mutant protein. Assume all mutations in each…#3 The heme group is a prosthetic group in: 80 F3 וח E D A) Fetal hemoglobin B) Adult hemoglobin C C) Myoglobin D) a and b E) a, b, and c F) b and c $ 4 F4 R F % 5 V ܀ F5 T G ^ B MacBook Air F6 Y H & ◄◄ F7 U N * 00 8 J DII F8 - M ( 9 K DD F9 O V I :) 0 4 F10 P |IV. Find 10 words that are related to the topic (Prokaryotic vs Eukaryotic Cells) hidden in the grid. The words may be hidden in any directions. Write each word on the space provided below.