Transcription in eukaryotes requires which of the following? Choose ALL that apply. the protein product of the promoter ribosomes and tRNA Transcription Factors start and stop codons RNA Polymerase aminoacyl-tRNA synthetase

Transcription in eukaryotes requires which of the following? Choose ALL that apply. the protein product of the promoter ribosomes and tRNA Transcription Factors start and stop codons RNA Polymerase aminoacyl-tRNA synthetase

Name: Give detailed Solution with explanation needed..don't give Handwritten
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Give detailed Solution with explanation needed..don't give Handwritten answer..don't use Ai for answering this Transcription in eukaryotes requires which of the following? Choose ALL that apply.the protein product of the promoterribosomes and tRNATra

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 2P: The Events in Transcription Initiation Describe the sequence of events involved in the initiation of...

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Transcription of a typical gene encoding a polypeptide in eukaryotes involves all of the following EXCEPT: transcription of DNA corresponding to both introns and exons. transcription of the DNA corresponding to the gene of the polypeptide which may include UTRS (c) RNA synthesis by RNA polymerase II. the splicing together of a number of exons in the DNA prior to transcription.
Transcription Translation stop site start site Intron 1 Promoter Exon 1 Exon 2 Intron 2 Exon 3 | Transcription stop site What kind of mutation would you introduce to render the gene above such that it is expressed with a normal functioning protein, but less protein produced overall compared to the non-mutated gene? Explain in 1-2 sentences, including where the mutation would be located.
mRNA sequence of A gene Find 5’ UTR and 3’UTR of mRNA 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Mark the point at which transcription will terminate
Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -Termination
The sigma subunit of bacterial RNA polymerase ________________________. is required for the initiation of transcription binds to the RNA polymerase core enzyme must be released from the RNA polymerase for transcription to enter the elongation phase binds to the bacterial promoter sequence All of the other answers are correct.
In eukaryotic transcription, which of the following is not included in the initiation of transcription? Group of answer choices RNA polymerase II TATA box Holoenzyme AAUAAA consensus sequence
If there are multiple start condo, how can you identify the real start codon? By observing Okazaki fragments By identifying splicing site Using sequence data bases By identifying Kozak sequence Which one is not a part of the transcription unit? RNA primase Promoter RNA coding sequence Terminator
What will be the overall anti-codon sequence in tRNA for this mRNA? 5’-GUAGCCUUAUCUAGCGAUCACCGUCCGUAUUACUAGUGGCCAGACUCUUUUCACCAUGUAUAGUUG-3’
Insert Table Chart Text Shape Media Comment Which of the following statements regarding "start" and "stop" signals apply to both transcription and translation? the start and stop signals are "read" (i.e., interpreted) the start and stop signals reside within nucleic acid the start and stop signals are part of the genetic code the start and stop signals reside in RNA. start and stop signals are needed because the products must have a definite length and sequence.