Answered: Transcribe the given DNA sequences to…

Name: Transcribe the given DNA sequences to mRNA.DNA: 5'-GATCCGC-3'DNA: 5'-
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Transcribe the given DNA sequences to mRNA.DNA: 5'-GATCCGC-3'DNA: 5'-TTACGCTAA-3'DNA: 5'-ACGTCAATGGA-3'DNA: 5'-GCGCGGATTAGCGAT-3'mRNA: 3'-mRNA: 3'-mRNA: 3'-mRNA: 3'--5'-5'-5'-5'

Science

Biology

Transcribe the given DNA sequences to mRNA. DNA: 5'-GATCCGC-3' DNA: 5'-TTACGCTAA-3' DNA: 5'-ACGTCAATGGA-3' DNA: 5'-GCGCGGATTAGCGAT-3' mRNA: 3'- mRNA: 3'- mRNA: 3'- mRNA: 3'- -5' -5' in -5' in -5'

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Supply the missing information DNA: 3' mRNA: anticodon: amino acids: TAC-CCG-TCG-GGG-CGT-ATA-ACT 5' DNA: mRNA: 5' AUG-CGA-GGC-CCU-UUA-UAA-CCC 3' codon: anticodon: amino acids:
The sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5' - AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG - 3' 5'- ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG What is the sequence of the DNA template strand? TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCTC Incorrect -3' -3'
Molecule Sequence Hb A DNA 5’ GGC AGA CTT CTC CTC AGG AGT CAG GTG CAC 3’ Hb A mRNA Hb A protein Hb S DNA 5’ GGC AGA CTT CTC CAC AGG AGT CAG GTG CAC 3’ Hb S mRNA Hb S protein transcribe and translate each sequence making the mRNA and protein sequence of each
Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'
he sequence is read from left to right. The table below shows which mRNA codons code for each type of amino acid. UUA - Leu | UCA - Ser UAA - Stop | UGA-Stop UUU - Phe | UCU - Ser UAU- Tyr UGU- Cys CỦA - Leu CCA - Pro CAA - Gln | CGA - ArgA UUG - Leu UCG - Ser| UAG-Stop UGG- TrpG A DNA sequence before and after replication IS SHO Second mRNA base G DNA sequence before replication: UUC - Phe UCC -Ser UAC U TACCTAGCT Туг UGC Cys DNA sequence after replication: A TACCTCGCT Leu CCU - Pro CAU - His CGU. CUU Arg U - Pro CAC - His CGC- ArgC CUC - Leu ССС Pro CAG - Gln | CGG - Arg G CUG - Leu CCG Thr AAU - Asn AGU - Ser Ile ACC - Thr AAC- Asn AGC Ile ACU AUU AUC Ser Lys AGA Arg Thr AAG - Lys AGG - AUA Ile ACA - Thr AAA- A mutation occurred in the DNA sequence during replication. Which of the following, A-D, Arg Asp GGU-Gly AUG - Met ACG GUU - Val GCU - Ala GAU - GỤC - Val GCC - Ala GAC - Asp GGC - Gly Val GCA -Ala GAA - Glu GGA - Gly Val GCG - Ala GAG-Glu GGG-Glv describes the result of the…
26. Using the following DNA strand, write out the mRNA, and then the amino acids. DNA: 3' T- A- C- A- A- G- T- A- C- T- T- G- T- T- T- C- T- T- A- A- A 5' A LIGUULAUGAOLAAAGAAUUL Phe- MRNA: Amino Acids: met Phe- met Asme -LyS- G la- 27. Suppose the two guanosine (G) nucleotides in3 above were changed to two cytosine (C) nucleotides. What is the new amino acid chain? 28. Suppose the two guanosine (G) nucleotides in #3 were removed from the DNA strand. How would this mutation affect the amino acid chain? Write out the new amino acid chain.
Given the following stretch of mRNA, what would be the sequence of the corresponding non-template DNA? 5' - UUG-CAA-UCG-CAG-UGC-CGC-AUA-GAU - 3' Group of answer choices 3' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 5' 5' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 3' 5' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 3' 3' - AAC-GUU-AGC-GUC-ACG-GCG-UAU-CUA - 5' 3' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 5'
The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter Gly
Arg-ser-ser-ala-pro Possibilities mRNA 3’ AGG UCA UCU GCU CCC 5’ 5’ ACC ACG CCU CCU GGC 3’ 3’ UCC ACG CCU ACU GGA 5’ 5’ CGC UCC CCU GCC CCC 3’ Possibilities coding strand 5’ TCC TCG ACT GCT GGA 3’ 3’ TCC TCG TGA CGA CGC 5’ 5’ CGG ACT ACT GCA CCA 3’ 3’ CCC ACG ACT CCT CGC 5’ Possibilities non- coding strand 3’ GGG TCA TCA CGG GGG 5’ 5’ TCC AGC AGC CGC GGC 3’ 3’ GCC TCA AGC CGA GGA 5’ 5’ TGG TGC TGA AGA TCA 3’
Refer to the DNA template strand below. Which of the following corresponds to the protein coding sequence portion of the corresponding mRNA? 5' - CTGTATCCTAGCACCCAAATCGCATTAGGAC - 3' O 5'- ATG CGA TTT GGG TGC TAG - 3' O 5' - AUG CGA UUU GGG UGC - 3' O 3' - GAC AUA GGA UCG UGG GUU UAG - 5' O 5' - CTA GCA CCC AAA TCG CAT TAG - 3' O 3' - GGA CAU AGG UAC GUG GGU UUA GCG UAA UCC UG - 5'
What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'