TOPIC: TEENAGE PREGANANCY Home Visit Plan Background/Rationale: Goal: DATE AND TIME SPECIFIC OBJECTIVES АCTIVITIES METHODS/STRATEGY/MATERIALS EVALUATION (SEPT 26-29) TO BE USED DAY 1-3
Q: Subject Name : Adult Nursing Theoretical NOTE : Choose the correct answer without explaining. 1-Most…
A: Fatty liver It is defined as accumulation of excessive triglyceride in the liver cells. Stages:…
Q: Bipolar patients NPI (Nurse patient interaction) questions
A: A patient with bipolar disorder manifests with extreme mood swings. Mood changes may range from…
Q: Croh’n disease - DEFINITION - PREDISPOSING FACTORS - SIGN AND SYMPTOMS - ANATOMY AND…
A: Crohn disease are chronic, relapsing inflammatory bowel disease (IBDs) of unknown origin. It is…
Q: Order: Morphine sulfate 7.5 mg, subcut, q4h, PRN Child's weight: 84 lb Recommended dose range: 0.1…
A: According to the label on the vial, the vial contains 5 mg drug in 1 ml. The order prescribes 7.5 mg…
Q: Order:Morphine sulfate 7.5mg, subcutaneous, q4h, prn. childs weight: 84 lb Recommended dose range:…
A: The weight of the child = 84 lbs Ordered dose = 7.5 mg, subcutaneous q4h, prn q4h means 6 times a…
Q: Concept Map which consists of: 1 nursing diagnosis 1 Goal 3 Nursing interventions with rationale…
A: Concept Mapping is a way for appropriately planning and arranging the care plan into diagrams so it…
Q: "State the legal questions pertaining to Drug Information practice concerning malpractice." -…
A: Medical malpractice occurs when a health care professional or provider neglects to provide…
Q: Disorder Risk factors/ Diagnostics Signs and Organ/system Pharmacologic Nursing Causes/Predisposing…
A: Since we only answer up to 3 sub-parts, we'll answer the first 3. Please re-submit the question and…
Q: stion 3 Treating an older adult like a child is a form of abuse? True False
A: Adults are an important aspect of life. They need special care like a child. Older adults usually…
Q: S B is a 54-year-old Latina female who went to her healthcare provider with complaints of heartburn,…
A: Gastro esophageal reflex disease ( GERD) is a digestive disorder. Here the stomach acids irritates…
Q: Self Care deficit related to lost of loved one or caregiver as evidenced by patient verbalizing…
A: Diagnosis: Self Care deficit related to lost of loved one or caregiver as evidenced by patient…
Q: Case: The Perez family of Barangay lsidro in Mendez, Cavite has a 2-year-old son who appears to have…
A: Hygiene and sanitation-: Maintaining hygiene and sanitation is very important to check the growth of…
Q: Nursing diagnosis :- 1. Social isolation 2. Self care deficit Include what each nursing…
A: Mr. Snape is 73 year old widower. He is living alone in his home from past 5 months. He…
Q: Q1. Prescription: Morphine 1mg po q2h PRN for pain Available: Morphine 5 mg/mL How many mL will the…
A: Morphine is an opioid analgesic that is used for the treatment of severe pain. It can be…
Q: Major depressive disorder (MDD) write: Q1: Treatment modalities (pharmacology ,…
A: A mental health disorder characterised by a consistently sad mood or a loss of interest in…
Q: TOPIC: TEENAGE PREGANANCY Home Visit Plan Background/Rationale: Goal: DATE AND TIME SPECIFIC…
A: In this question it is to describe about the health teaching plan of teenage pregnancy.
Q: 1. Identify at least 3 risk factors for impaired nursing that were seen in this case study 2.…
A: Hello, as your question has many parts, we will only answer the first three parts for you and if you…
Q: Appendicitis - DEFINITION - PREDISPOSING FACTORS - SIGN AND SYMPTOMS - ANATOMY AND…
A: Appendicitis is inflammation of appendix
Q: diabetes complains of hunger. the patient is sweaty, cold and clammy.
A: As experts, nurses have to develop their skills toward any co-morbidities and comprehending the…
Q: choose one option only The nurse is receiving the medical record of an older adult client with a…
A: Nutrition plays an important role in maintaining the overall health of individuals. Eating a…
Q: Top 2 nursing priority diagnosis
A: A pneumothorax is a medical disorder characterised by the presence of air or gas in the pleural…
Q: Social isolation related to loss of loved one as evidenced by living alone in the home since last 5…
A: In healthcare, the setting nurse provides care based on systematic and organized guidelines. This…
Q: TOPIC: TEENAGE PREGANANCY Home Visit Plan Background/Rationale: Goal: DATE AND TIME SPECIFIC…
A: Here, in this question it is asking that to plan a health teaching about teenage pregnancy .
Q: ocial isolation related to loss of loved one as evidenced by living alone in the home since last 5…
A: Social isolation related to loss of loved one as evidenced by living alone in the home since last 5…
Q: Case Study, Chapter 35, Nursing Diagnosis and Planning Your client, Mrs. O'Bryan has been admitted…
A: Nursing process plays a major role in the nursing profession. This will help the nurse to assess,…
Q: NURSING CARE PLAN Cues Nursing Analysis Goal Intervention Rationale Evaluation Diagnosis (with…
A: Postpartum constipation is common after delivery. It occurs due to irregular movement of bowels due…
Q: Diagnosis CHF Nursing Activities/Interventions with each rational
A: Congestive heart failure (CHF) is a global public health issue that has risen in both incidence and…
Q: The nurse is conducting a health teaching to a patient during administration of a drug. Which of the…
A: Here, a nurse is conducting a health talk regarding the adverse effects of drug administration. Now…
Q: Develop a list of nursing care measures employed during the detoxification treatment of clients with…
A: Detoxification is a set of actions aimed in managing the intoxication an withdrawal. It clears the…
Q: Develop a nursing care plan that includes all phases of the nursing process for patients taking…
A: The nursing care plan is a direction or means of communication with the prescribers, patients, and…
Q: pediatric drug safety and administration with current or potential nursin
A: Due to the developmental factors as well as the smaller body size, infants and young children…
Q: Table 2: Characteristics of study patients Patient group; mean (and SD)* Appropriate use (n = 4671)…
A: Standard Deviation in Population --The standard deviation is a statistics which measure the…
Q: Priority Nursing Diagnoses: 1. 2. 3. 4. 5. Priority Health Promotion Areas: 1. 2. 3. 4.…
A: Nurses are an important pillar of a healthcare system that provides proper care and ensures the…
Q: Health Problem: Inability to provide adequate nursing care to the sick, disabled, dependent or…
A: Criteria Weight Scoring Justification 1. Nature of the condition or problem presented…
Q: sevier.com/#/content-player?assessmentVtwld=afcd4cb0-17dd-4437-82f1-ce5cb069ddf9&instanceld-bundle_2…
A: Anti embolism hose are tight- fitting elastic stockings used in bedridden patients to compress the…
Q: ACUTE OCCUPATIONAL POISONING OCCURS AFTER 1. systematic long-term exposure to small concentrations…
A: Occupational poisoning occurs when a worker of factory get exposed to toxic substance used in that…
Q: Write the nursing diagnoses for the case scenario below. Mang Ping, 62 y/o male who is relatively…
A: A nursing diagnosis is a problem-focused approach where the relative defining characters of a…
Q: arance as evidenced by increased in weight, overweight BMI classification and patient stated that…
A: A nursing care plan can be defined as the structured provision of nursing care to patients based…
Q: Develop a case scenario pertaining to a patient with Eyes or Ears or Nose disorders. It must include…
A: Nursing counselling and advise involves certain intervention which helps process focusing on the…
Q: CASE STUDY: Wilma is an 84-year-old widow who lives independently alone, in her North Adelaide…
A: Progressive neurological disorder Nervous system undergoes many natural changes due to ageing…
Q: What are the alternatives for treatment when a patient has VRSA and the target for VRSA?
A: Bacteria are microorganism that most commonly occur in the soil, air, water and in adverse…
Q: G1: CASE ANALYSIS A 28 year old woman is seen with an easy fatigue for a couple of months. She is…
A: Symptoms mentioned here for 28 years old lady with two babies in 2 years Symptom 1: Taste of eating…
Q: What is the most applicable and urgently needed for the above situation?
A: This process is centred on the family to make them aware regarding importance of health with the…
Q: Formulate an Actual Nursing Diagnosis, Risk Nursing Diagnosis, and Health Promotion Diagnosis for…
A: The body contains approximately 75% of water. However, the concentration of water can reduce…
Make a home visit plan about teenage pregnancy. (health teaching)
important notes:
- specific time and date should have specific objectives.
- day 1-3 of health teaching.
Step by step
Solved in 3 steps
- Reporting Category 4: Biological System and Processes Fill in the function and major organs of each system, as well as how they interact with other systems. Use the Functions Word Bank provided at the end of table to help complete the table. Interaction(s)- Working with Other Systems Function(s) Diagram System Digestive 1. With circulatory: Hem.cullalar netahe fron rir(oiltion is List the major organs: Insi 2. With muscular: Phoc tk henel oninary blackler wheter let 3. With nervous: \ 3) Fla homeasto ndtestnavclient.psonsvc.net/#/question/3c84727c-923f-43e6-b886-7a4df16a5c34/87dc7a9e-4def-4dd2-8ad8-724b9a914198 Review - A Bookmark tete, edilmar AKE S2 Bio Unit 5B Common Unit Assessment / 1 of 9 II Pau Use the picture to answer the following question. Plant Grasshopper Frog Snake Eagle Suppose 10,000 units of energy are available at the level of the plants. How many energy units would be passed from the frog to the snake? O A. 100 units O B. 1,000 units O C. 10 units D. 10,000 units Sign outReporting Category 4: Biological System and Processes Fill in the function and major organs of each system, as well as how they interact with other systems. Use the Functions Word Bank provided at the end of table to help complete the table. Interaction(s)- Working with Other Systems System Function(s) Diagram Digestive List the • 1. With circulatory: major organs: 2. With muscular: 3. With nervous: Circulatory List the major organs: 1. With respiratory: 2. With digestive: 3. With immune: 4. With nervous: 5. With endocrine: Nervous List the major organs: 1. With muscular: 2. With endocrine:
- CS_Chapter 34.docx nd.orbundsis.com/einstein-freshair/Videos/D671260A4C0A005E4832B3E307A98B64/CS_Chapter_3- (6) The Reason Why... om: Onlin... + Beyond The Lights... Isaiah Blames Zora... Watch Mar ase Study, Chapter 34,Nursing Assessment 1. Mr. Simms has been admitted to your unit complaining of chest pain. You introduce yourself to Mr. Sims and begin the nursing assessment. How will you explain the significance of the nursing assessment to Mr. Simms? (Learning Objectives 1, 2) 2. The following information is data collected from Mr. Simms. Label each piece of data collected with an (s) for subjective data or an (o) for objective data. Mr. Simms is a 65-year-old male presenting with "crushing chest pain radiating down the left arm to the fourth and fifth fingers." Temperature 99.0°F Pulse80 Respirations 16 Blood pressure 190/98 Oxygen saturation 96% 3. List three ways you will collect data from Mr. Simms. Complaints of nausea and dyspnea. Skin moist and pale. Oriented to person, place,…8:41 X Case Study 4 - Reproductive.docx : Case Study 4 - Reproductive Disorders Instructions: All questions apply to this case study. Your responses should be brief and to the point. Cite reference page(s) from Timby, Rosdahl, Drug Guide and ATI books. When asked to provide several answers, they should be listed in order of priority or significance. Do not assume information that is not provided. L. A. is a sexually active 15-year-old who lives in a suburban neighborhood with her parents and two younger sisters. She does not confide in her parents about her activities, but rather discusses them with her two best friends in high school, who also are sexually active. Last week a guest speaker at school discussed the topic of sexually transmitted diseases (STDs) which L. A. thought quite a bit about since the discussion. She has an appointment tomorrow for her annual gynecologic examination. In the privacy of the examination room, L. A. tells the nurse about her sexual activity and…* My Home Content Take Test: Unit 1 Exam - BIOS x Q chapter 24 Flashcards | Quizle x O New Survey - UIC Healthchec X A uic.blackboard.com/webapps/assessment/take/take.jsp?course_assessment_id=_395458_1&course_id=_200855_1&content_id=_9051211_1&question_num_3.x=0... Apps Яндекс.Переводчи.. O Part-Time Lecturers. A Google Maps تمارين صعبة ولكنها ا. . . ي الشيخ عبد الباسط ع. .. رجيم كامل يحق ق التنح.. الزنجبيل وال ليمون أهم. . . E Reading list Remaining Time: 5 minutes, 42 seconds. * Question Completion Status: 12 Kauai Picture-winged Drosophila Oldest island Oahu Maui complex 40 - Youngest island 26 Hawaii © 2001 Sinauer Associates, Inc. Examine the figure above. Arrows represent times that an ancestral species of Drosophila moved from one island to another and underwent a speciation event. This movement promotes what kind of speciation? O Morphological speciation O Allopatric speciation O Ecological speciation O Sympatric speciation P Type here to search 5:13 PM 73°F O G 1x ENG 74…
- BIO 168 Case Studies Unit 5 gs Review View O Tell me 斗 AaBbCcD AaBbCcDdE AaBb AaBbCcDdEe AaBbCcDdEe A v H v No Spacing Normal Heading 1 Heading 2 Title Styles Pane Case Study #7 Ayoung woman was playing in a rugby game when she was knocked down. She was momentarily stunned, "saw stars," and had blurred vision for approximately 30 seconds. After resting for several minutes no symptoms remained except a lingering headache. 1. What may the lingering headache indicate? 2. After a few weeks the rugby player lost her sense of smell. Reexamination showed a fractured ethmoid bone. Why could this fracture cause the loss of her sense of smell? 3. Will it return? Why or why not?Test on the Prac X Apps Bb About this Modi x Question Completion Status: Secure https://blackboard.le.ac.uk/webapps/assessment/take/launch.jsp?course_assessment_id=_39582_1&course_id=_41417_1&content_id GIv Bag, Medical Dr... JD Fila Disruptor II R... 3. Edexcel Revisio... P Edexce Unavailable in you... www.20m 2.50M d. 0.208M e. 2.50MM QUESTION 8 Bb Reassessments X QUESTION 9 Palmar Oceanfron... Amazing Opportu... You need to make 500mL of a stock solution of sodium chloride at a final concentration of 250mM. How many grams of sodium chloride needs to be weighed out? The molecular mass of sodium chloride is 58.5. (Give you answer to 3sf) esc A 2.0kb bacterial plasmid 'BS1030' is digested with the restriction endonuclease Sau3A, the plasmid map is depicted in the diagram below and the Sau3A (S) restriction sites are indicated. S0.00/2.00 Bb About this Modi X Bb Practical report X indicates plasmid 'BS1030' fully digested with Sau3A? The DNA marker used is the 50 bp ladder, which…thl?deploymentld=5686091822001160682 CENGAGE MINDTAP 4 MindTap Assignment: Chapter 1 - Test Yourself Assignment: 1.4 MindTap Assignment: Chapter 1 - Test Yourself Questions fr3am08h_ch01.07m 2. 3. 4. Managed care: a. is not relevant in today's electronic medical office 5. O b. does not require any preauthorization for tests or surgeries 6. Oc. impacts the way medical assistants perform their jobs by adding additional paperwork 7. O d. is a thing of the past 8. O e. is not relevant in today's health care system 9. 10. 11. 12. 13. 14. 15. 16. 17. O- Icon Key 18. 19 fr3am08h_ch01.07m search
- pter 25- Google Docs New Tab tro/Case%20Study Trauma%28revised%29.pdf?time=1636054242025 1 / 1 100% + Case Study - Trauma You and your partner have been dispatched to a report of a motorcycle crash on a curvy back road. Fellow riders at the scene reported the patient was travelling too fast to negotiate a sharp curve and was thrown over a guardrail into a tree. They carried the patient up an approximate 4-foot embankment to the road. Upon your arrival, you find a male patient you estimate to be between 20-25 years of age, being cared for by a police officer who has opened the airway using an NPA and is administering oxygen via an NRB. The officer reports the patient has been unconscious since she got to the scene. Looking down the embankment, you see the patient's helmet and note it has sustained significant damage. As you approach the patient, you observe the patient has gross angulation involving his left lower leg and deformity to his right humerus. 1. In addition to scene safety,…II Log In x b My Que X d.cuny.edu/webapps/assessment/take/take.jsp?course_assessment_id%3 2077934_ 1&course_id%3 2021853 18content id 62810464 18 Remaining Time: 1 hour, 31 minutes, 54 seconds. * Question Completion Status: Moving to the next question prevents changes to this answer. Question 2 AAGTCAAGAAGAAGAAGAAGCC A. The nucleotide sequence above is a STR of how many repeats? B. What sequence is being repeated? For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac), TTTArial 3 (12pt) E: - L ^ The nucleotide sequence5 above is 5 The sequence being repeated is AAG I 41°F e here to searchCW7 Due 3/1 X C Chapter 5: In x M Inbox (3,574) X M Inbox (244) M Midterm ma X b Search result x G how to scree + https://peralta.instructure.com/courses/39459/quizzes/131066 B MERRITT |COLLEGE Account Dashboard Courses Skin Drawing 1 Calendar Using Skin Drawing 1, match the tissue types on the right column to the lettered regions in the left column: Inbox A keratinized stra History В dense irregular Studio C areolar connect Starfish D Help reticular conne 3:58 PM O Type here to search ENG 3/22/2021