the following statements, answer TRUE or FALSE and explain your answer briefly. Capillary electrophoresis cannot be applied in Sanger method, if there is an absence of fluorescence tags on dideoxynucleoside
Q: One objection many people have about vaccinations is the amount and variety of chemicals in them.…
A: Vaccination is a simple, safe and effective way of protecting you against harmful diseases. It uses…
Q: Rapidly dividing cells such as bone marrow, skin, intestinal mucosa, and cancer cells need DNA…
A: Cancer is a disease defined by the uncontrolled development of a group of abnormal cells that can…
Q: Albinism is a rare genetically inherited trait that is only expressed in the phenotype of homozygous…
A: The homozygous recessive genotype (aa) caused albinism in the population. AA and Aa genotypes encode…
Q: B 1. Name the region of the hair labeled A. 2. Name the structure labeled B. 3. Name the specific…
A: Skin is the outermost protective covering of the body and is the largest organ it is composed of…
Q: For this statement, answer True or False and explain your answer briefly. In the precipitin test of…
A: Precipitin test is a simple serological technique that shows the precipitin reaction in solution.…
Q: comparative anatomical structures
A: Comparative anatomy: One hint of evolution comes from the Comparative anatomy. The study of…
Q: Based on the milkfish dissection, describe the structure of skull and vertebral column design. How…
A: Answer :: Milkfish (Chanos chanos) is the only fish species that belongs to Family Chanidae which is…
Q: What is a TED talk? TED stands for "Technology Entertainment
A: TED is a global community, welcoming people from every discipline and culture who seek a deeper…
Q: 3.' To determine the effect of the bicoid gene, scientists injected bicoid mRNA into the posterior…
A: Introduction Bicoid is a morphogen that regulates the expression of genes in the anterior of a…
Q: Briefly describe (two or three sentences) the role of tRNA in building a protein from mRNA.
A: Genes include instructions for making proteins. They do not, though, produce proteins directly.…
Q: Which is FALSE about the protein that regulates tryptophan biosynthesis? O The recognition helices…
A: The trp operon, found in E. coli bacteria, is a group of genes that encode biosynthetic enzymes for…
Q: All of the following are generated directly during the Krebs (TCA) cycle except? a. ATP b. GTP c.…
A:
Q: To summarize: The concept of energy flow through a food web.
A: The Sun provides energy to the Earth in the form of light. The organisms efficiently exploit the…
Q: In a population of snapdragons, at the locus controlling flower color you find that 0.2 are AA, 0.65…
A: Given: AA = 0.2 Aa = 0.65 aa = 0.15 Need to find the inbreeding coefficient.
Q: Zika virus infection, a zoonotic disease, produced somewhat sizable outbreaks recently in certain…
A: To explain: To explain about Zika virus infection and dichotomy
Q: The O-antigen is part of the bacterium's which is found in the outer membrane of some bacterial cell…
A: Introduction Antigen:- It is any substance that causes the body to make an immune response against…
Q: In the evolutionary tree, sexual reproduction first appeared in which group of organisms? plants…
A: Answer
Q: Albinism is homozygous recessive (aa). A sister with normal coloration has a sister that has…
A: Albinism is a disorder of autosomal recessive inheritance. Albinism inhibits melanin production,…
Q: 1.Compare the structures of ATP to these nucleic acids: cAMP, dinucleotides, RNA, DNA. Your…
A: Nucleic acids include DNA and RNA. The DNA and RNA stand for deoxyribonucleic acid and ribonucleic…
Q: To explain: The way in which the plants with nodules for nitrogen-fixing bacteria might…
A: Nitrogen fixation is the process through which atmospheric nitrogen is converted to ammonia through…
Q: Describe the unique way that auxin can move through a plant.
A: Auxins are a type of plant enzyme that resembles morphogens in some ways. Auxins are important for…
Q: Describe an ELISA test to detect the presence of HIV antibodies in a patient.
A: HIV is a virus than can cause AIDS if not treated .ELISA is the one of the test to screen HIV .…
Q: Study the diagram below. Put the number of the step in the diagram by its description in the list of…
A: Restriction DNA technology can be defined as a set of techniques ; in which DNA is identified DNA;…
Q: Q4) The relative volume of red blood cells can be known by measuring the hematocrit (the ratio…
A: Blood It is a type of connective tissue that connects whole body. It carry oxygen to every cell of…
Q: Question 5 Describe briefly the TWO distinct roles of the v-SNARE and t-SNARE proteins in vesicle…
A: Role of SNARE proteins in vesicle transport :-
Q: Please discuss the value of international normalized ratio (INR) as a test. Why do you think this is…
A: PT test is the normal blood test conducted to record the time taken for blood to clot.
Q: Question 19 Based on the hydropathic index plot below, where in the 3D structure of the protein…
A: To study hydropathy index, we should first note down the following points: Integral proteins are…
Q: S-phase arrest in response to glutamine deprivation in KRas-driven cancer cells can be reversed by…
A: The shortage of deoxynucleotides required for DNA synthesis causes KRas-driven cancerous cells to…
Q: Create a food web of an Urban Ecosystem (UTAH) 1. Include: producers, primary, secondary, tertiary…
A: An ecosystem can be defined as a functional unit of nature, where living organisms interact among…
Q: Question - What is biology? A) The study of DNA. 3) The study of the environm C) The study of life.…
A: Science is the intellectual and practical activity encompassing the systematic study of the…
Q: What is the difference between anatomy and physiology? How do these two sciences support each other?
A: The human body is a structure made up of many different cell groups that work together to form a…
Q: Which option is option D?
A: Look at the last figure, the bottom right side, showing great time interval for the second action…
Q: In contrast to our jaws. which move up and down, the mouthparts of arthropods move side to side.…
A:
Q: Distinguish between catabolism and anabolism.
A: Metabolism refers to the chemical events that take place in the cell to produce energy. The acquired…
Q: Indirect bilirubin water insoluble * True O False The ALP are a group of enzymes that hydrolyse in…
A: Bilirubin is found in 2 states ; Direct and Indirect bilirubin. Indirect bilirubin is not conjugated…
Q: Kernel color in wheat is controlled by 2 pairs of genes (AABB). Determine the color of each…
A: The inheritance of kernel color in wheat is controlled by two genes. These are A and B genes.
Q: Which of the following structures are involved in balance/equilibrium? Select all that apply.…
A: A. Cerebellum controls posture and balance. Semicircular canal, Vestibule and cochlea are part of…
Q: 2. Consider the following paragraph from a peer-reviewed publication detailing the extraction and…
A: Lectins These are defined as glycoproteins. They have the ability to make bonds with carbohydrates…
Q: Calcitonin is enzyme that functions to reduce blood calcium levels
A: Calcium may be a mineral that's found in a very form of foods. calcium is needed by the body to take…
Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…
A: DNA contains the genetic information about the characteristics features of te organism present in…
Q: Apopulation is expenencing only selection Alele A1 is favored by selection and starts at a frequency…
A: ANSWER;- 4th and 5th Options are the Correct Answer. Explain;- The Phenomenon Like Natural…
Q: Provide an illustration and describe the different types of egg as to the concentration of yolk they…
A: Isolecithal eggs : It is a type of holoblastic egg.. In this type yolk distribution is same that is…
Q: Choose which does NOT belong to the group then give the commonality of the remaining 3 terms 1.…
A: In plants; each part have different roles to play for the proper development of plants.
Q: Calcium deficiency disease can lead to a health problem, where the level of calcium in the blood was…
A: The calcium level in the blood is excessively low in hypocalcemia. A low calcium level can be caused…
Q: To brachiate is to O move around suspended from branches like a Siamang to leap from tree to tree…
A: Evolution can be defined as the unrolling of nature that brings about an orderly change from one…
Q: 9. Coronary arteries route oxygen rich blood into the tissues of the heart. They branch off of the:…
A: As per our honor code, we are allowed to answer only one question at a moment. You have posted…
Q: 1. What are the major adaptations that allow nemertines to thrive in the marine environment? Support…
A: Adaptation: It is a process of evolution that allows any particular organism to be well suited for…
Q: Fill in the negative homeostatic feedback loop to determine how your body will respond hormonally to…
A: Blood pressure is the blood circulation pressure against the sides of the blood vessels. The bulk of…
Q: Describe the role of ethylene in fruit ripening
A: Botanically a fruit may be defined as the seed-bearing structure which is found in the flowering…
Q: To explain: The typical pyramids of numbers, biomass, and energy.
A: The sun provides energy to the Earth and actually defines that they're supposed to form through and…
For the following statements, answer TRUE or FALSE and explain your answer briefly.
Capillary electrophoresis cannot be applied in Sanger method, if there is an absence
of fluorescence tags on dideoxynucleoside triphosphates.
Step by step
Solved in 2 steps
- The order is for Streptomycin 1gm IM. You have a 5gm vial of Streptomycin . The label states to add 9ml of sterile water to yield 400mq / m * l How many ml will you give?Determine the concentration of L. monocytogenes enumerated from the apple slice based on the information below. You must draw your serial dilution and show your mathematical calculation. The apple slice (12 g) was first mixed with 108 ml of sterile 0.1% peptone water. After, 1 ml was added to tube containing 9 ml of sterile 0.1% peptone water. Process was repeated with two additional tubes. 1 ml was pipetted from tubes 2 and 3 onto MOX media. Plates were incubated at 37 for 48 hours. The pictures below show the plates from tube 2 (left) and tube 3 (right).A hospital pharmacy has available 2-mL prefilled syringes containing 80 mg of tobramycin and 1.5-mL prefilled syringes containing 60 mg of tobramycin. The syringes are calibrated in 0.25-mL units. Explain how you would prepare a medication order calling for 110 mg of tobramycin to be added to 100 mL of D5W for intravenous infusion.
- You have an order for 1 gram of Cefazolin in D5W 100 ml. You have added 5 ml of sterile water to the 1 gram vial to reconstitute powder. However the recommended manufacturer’s diluent amount is 10 ml of sterile water for a final concentration of 100 mg/ml. How would reconstituting the vial with 5 mls affect the concentration and the final calculated dose. Please answer with explanation ASAP. I will really upvote. ThanksThe solution was graded as incorrect in my homework. Is there another option for this question?A cat presents with suspected acute, severe sepsis. The veterinarian asks you to draw up a dose of IV gentamicin. The dosage for a cat with acute sepsis is 2.2 mg/kg. Calculate the dose for an 8-lb cat. The concentration of gentamicin is 50 mg/ml. Show me your calculation Please note that: 1Kg= 2.2 lb
- To the right is an image of a dilution that was performed. The volume above the top arrow indicates the volume that should be transferred to the next tube (i.e. Tube 1). The volume listed at the bottom-right of tube 1 indicates the volume of diluent that should be added to that tube. The stock concentration is 50μg/ml and you want to make a solution in tube 1 with a concentration of 0.4μg/ml and a total volume of 3ml. Stock ?ml Tube 1 ?ml a. How many milliliters of stock solution needs to be added to Tube 1? Round your answer to three decimal places (e.g. 0.111). b. How many milliliters of diluent needs to be added to Tube 1? Round your answer to three decimal places.Your pharmacy has on hand Tetracycline 250 mg/5 mL liquid.You receive a prescription for Tetracycline syrup 500 mg qid for 7 days. How many total milliliters would you dispense? Your pharmacy has on hand Prednisone 5 mg tablets.You receive a prescription for Prednisone 5 mg ii tabs stat and qid x 1 day, then ii tabs tid x 2 days, then ii tabs bid x 2 days, then i tab tid x 3 days, then i tab bid x 3days, then i tab qd x 4 days How many tablets would you dispense for this prescription? How many days will the patient take this medication for? Your pharmacy has on hand Dilantin 100mg capsules.You receive a prescription for Dilantin 100 mg 1 cap po in the AM & PM, 200mg (2 caps) po at noon, and 300mg (3 caps) po at hs. Dispense a 30 day supply. (using the 100mg capsules you have in stock) How many capsules will you dispense? Your pharmacy has on hand Dakins Irrigation Solution 1 liter.You receive a prescription for Dakins Irrigation Solution Irrigate chest tube with 100 mL…Read this article and answer the following question There are 3 different Metformin ER products available: Glucophage XR Glumetza ER Fortamet ER All 3 formulations are available generically but they are not interchangeable as they all use different release mechanisms. Glucophage XR uses a dual hydrophilic polymer system. The drug is slowly released by diffusing through a gel matrix, also known as GelShield diffusion system. Once the tablet is swallowed, the outer layer of the tablet forms a gel layer and the metformin contained within is slowly released. Due to this release mechanism, Glucophage XR can not be cut or split. Glumetza ER uses a mechanism known as gastro-retentive technology (also known as 'Modified Release'). The tablets are designed to remain in the stomach and deliver metformin to the upper GI tract over an extended period of time. Like Glucophage XR, Glumetza ER can not be cut or split. Fortamet ER uses single-composition osmotic technology (SCOT). After…
- AE, 62, Male Wt: 75 kg, Ht: 150 cm Orders: Penicillin G Potassium 10,000,000 Units Sterile water for injection qs Make a 250,000 U/mL solution. The package insert states If Penicillin G Potassium 10,000,000 Units is reconstituted with 44 mL sterile water, a solution of 200,000 U per mL will be obtained. What volume of sterile water would you use to reconstitute the penicillin G potassium in order to make the ordered solution?a 55 -year-old man who has upon catheterization two-vessel CAD. He has adverse effects on nitrates and refused to use them again because they cause severe headaches. His medical history includes asthma and hyperlipidemia. What drug do you choose for him? Specify the name of the drug or its specific class? And Why?The usual dose of digoxin for rapid digitalization is a total of 1.0mg, divide into two or more portion at intervals of 6 to 8 hours. How many milliliters of digoxin elixir containing 50mcg/mL would provide this dose?