The 5’-ACTGCA DNA probe will hybridize with (stick to) which of the following DNA strands?a. 5’-TGACGTb. 3’-UGACGUc. 5’-GGCAAUd. 3’-TGACGTe. 5’-CCGUUA
Q: please compare skin and gills system and tracheal system by discussing the differences and…
A: Each respiratory system exhibits unique adaptations to temperature and concentration gradients based…
Q: Step 1- Transcription O O O Function: A single strand of Location: In the Steps of Transcription 1.…
A: Step 1- Transcription• Function: A single strand of **mRNA (messenger RNA)** is made from **DNA**.•…
Q: How can people keep their cardiovascular health healthy?
A: Heart failure, stroke, peripheral artery disease, coronary artery disease, and other disorders…
Q: Class garticipation Q#3 What is the relationship between the two structures of…
A: The objective of this question is to understand the relationship between the two structures of…
Q: You are purifying a protein for the first me and decide to analyze it on SDS PAGE. You run two lanes…
A: A. This finding implies that the protein likely has disulfide links in its natural state. Disulfide…
Q: Exercise 6 & 7: Acid-fast stain: what component/structure in the cell wall is stained?; be able to…
A: Staining is a process where different types of stains or dyes are used to color the part of the cell…
Q: Having identified the genetic identity of the parent flies female is RrGg and male is Rrgg. (R is…
A: The simultaneous transmission of the two genes involved (eye color and body color) from the parent…
Q: MEAT PRODUCTION CHARACTERISTICS OF PEKIN DUCK
A: Fast growth: Pekin ducks are known for their fast growth rate, reaching slaughter weight in as…
Q: SCIEN
A: Identify cell type Prokaryote or EukaryoteThe organism is a eukaryote and the structure the arrow is…
Q: Polymers may be composed of thousands of monomers. Draw three repeat units of styrene. Assume there…
A: When styrene is heated, it undergoes thermal polymerization, a process where small molecules called…
Q: Duchenne muscular dystrophy (DMD) is an example of an X-linked trait. This is a neuromuscular…
A: Duchenne muscular dystrophy (DMD) is an example of an X-linked trait. This is a neuromuscular…
Q: The Egyptian myth of Osiris and Seth, the Greek myth of Oedipus and Laius, and the later Egyptian…
A: The objective of the question is to identify the common theme shared by the Egyptian myth of Osiris…
Q: 10) 22 A *no surface antigens You just made Blood type Plasma Antibodies present 10 bodia A * Add…
A: Please refer below for the answerExplanation:
Q: The domesticated dog (Canis familiaris) belongs to which of the following chordate classes? class…
A: The objective of the question is to identify the chordate class to which the domesticated dog (Canis…
Q: Choose a parasite and discuss how co-evolution has influenced its relationship with its host. Be…
A: The reciprocal evolutionary effect that results in mutual adaptations over time between two or more…
Q: Part 2: The diagram below shows the main components of the female reproductive system. A B C D E
A: The uterus, scientifically termed the womb, stands as a vital organ within the pelvic region,…
Q: In E. coli, the DNA helicase is loaded onto the DNA by __________ and activated when __________…
A: Cell division depends on DNA replication, which needs exact control over the double helix's…
Q: Which season of the Babylonian year corresponds to the darkest night (midnight to dawn)? Spring,…
A: The objective of the question is to identify the season of the Babylonian year that corresponds to…
Q: What nitrogenous base is considered to be damage if found in DNA? Adenine Thymine…
A: The integrity of DNA is crucial for the accurate transmission of genetic information during cell…
Q: i s the same as cholinergic, producing the effect of acetylcholine or an agent that mimics…
A: The term 'cholinergic' refers to any neuron or cell that uses acetylcholine as its primary…
Q: is this the same as the Bmax because i need to find the bmax
A: For the maximum binding capacity (Bmax), you need to identify the maximum specific binding (pmol/mg)…
Q: What are the arguments for and against pathogenic gain-of-function research? What do you think about…
A: Pathogenic gain-of-function research involves modifying pathogens to enhance their host range,…
Q: Vervet monkeys in the wild exhibit which of the following scientific skills? responding to a leopard…
A: The question is asking about the specific behaviors exhibited by vervet monkeys in the wild in…
Q: Demonstrate your understanding of DNA structure by circling the specific segment on the DNA double…
A: There are two types of nucleic acids present in our body, DNA and RNA. DNA acts as a genetic…
Q: Summarize the concept of the trade-off hypothesis in parasitology. Provide an example that is…
A: The trade-off hypothesis proposes a fascinating dynamic in the parasite-host relationship. It…
Q: Please compare tracheal systems vs. avian lungs by discussing the differences and similarities in…
A: Similarities:In tracheal system and avian lungs(birds lungs) have ventilation in which both system…
Q: closely linked open reading frames (ORFs) have been identified on the E. coli chromosome and they…
A: E.coli being a prokaryote consists of an operon which is the cluster of genes that helps in the…
Q: What type of reproductive strategy is used by frogs that lay hundreds or thousands of eggs at a…
A: The question is asking about the type of reproductive strategy used by frogs, which are known to lay…
Q: Place the path of light (using the numbers) in the microscope in the proper order as the light…
A: The correct answer is option b) 1, 3, 4, 2, 5.
Q: Please compare mammalian systems vs. avian lungs by discussing the differences and similarities in…
A: The objective of this question is to compare and contrast the mammalian respiratory system with the…
Q: Translesion synthesis (TLS)
A: When the DNA is damaged during the process of replication, a special phenomenon called Translesion…
Q: John performed a side-by-side Gram satin of a known Gram positive and known Gram negative organism.…
A: Gram staining is a type of staining technique that is used in microbiology to observe certain kinds…
Q: Can you write a critical analysis question for a dissertation on: The presence and nature of…
A: The topic of the dissertation revolves around the impact of comorbidities on the clinical trajectory…
Q: In what ways are dark field microscopy and negative staining alike?
A: Microscopy is a fundamental strategy in biological and materials science that permits analysts to…
Q: The peptidoglycan region in archaea is connected to each other by a: a) tetrapeptide b) Teichoic…
A: Peptidoglycan is a polymer crucial for forming the cell wall in most bacterial species. Comprising…
Q: Which term best describes the response of the plant taking place in the picture? hydrotropism
A: There are different types of responses in which plants respond to external stimuli by growing in…
Q: An U.S. unit is being used to measure the patient’s heartbeat using a 10 MHz signal – if the Doppler…
A: Given:• The transmitted frequency is equal to the one defined for the radio station f0 = 10 MHz = 10…
Q: Gram-stain: know steps, stains/reagents, and colors of Gm- and Gm+ after each step as well as…
A: Prepare the Slide: A heat-fixed bacterial smear is prepared on a glass slide.Primary Stain (Crystal…
Q: Classify the type of symbiotic relationship that exists between a bird and the tree in which it…
A: The objective of the question is to identify the type of symbiotic relationship between a bird and…
Q: Lifestyle of Escherichia Coli: General environment, lifestyle, and growth conditions of your…
A: E.coli is a gram negative, rod shaped, non-spore forming, motile bacterium. E. coli is a member of…
Q: Use the following to fill in the chart Species: great-horned owl human being mosquito opossum skunk…
A: A predator-prey relationship is a natural balance where one type of living thing, the predator,…
Q: Viruses that are enclosed by a membrane are more likely to be: a. a cause of GI discomfort b.…
A: Viruses enclosed by a membrane, also known as enveloped viruses, are more likely to cause lower…
Q: Which of the following animals may have been the second pet domesticated by humans, in Egypt or in…
A: Domestication means it is the process of adapting wild animals for human use. It is a mutualistic…
Q: Explain ONE suitable additional test the lab in London might use to determine the haemoglobin…
A: Sickle cell anemia is the most probable diagnosis for ema due to following results:Ema is…
Q: What are the answers to the second picture? The one on sex linkage
A: Cat Coar colour is sex linked characteristic, specifically this trait is X linked. As males have…
Q: Corneometer Values: Baseline moisture content Area 1:46 Average:43.7 Area 2:48 SD:4.79 Moisture…
A: We are going to do:Calculate the average and standard deviation for both Tewameter and Corneometer…
Q: 4. Distinguish between KM and Vmax.
A: KM reflects the affinity of the enzyme for its substrate, while Vmax represents the maximum rate of…
Q: Use the traits given in the completed character matrix to build a phylogeny of the six species (this…
A: Phylogenetic tree shows the developmental and evolutionary history of a species based upon its…
Q: Is the following case study an r-strategist or an K-strategist? Elephants live for about seventy…
A: The objective of the question is to determine whether the given case study of elephants is an…
Q: A sequence of DNA that provides coding information for the construction of proteins is called: A. an…
A: The question is asking for the term that describes a sequence of DNA that provides coding…
The 5’-ACTGCA DNA probe will hybridize with (stick to) which of the following DNA strands?
a. 5’-TGACGT
b. 3’-UGACGU
c. 5’-GGCAAU
d. 3’-TGACGT
e. 5’-CCGUUA
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- The 5’-ACTGCA DNA probe will hybridize with (stick to) which of the following DNA strands?a. 5’-TGACGTb. 3’-UGACGUc. 5’-GGCAAUd. 3’-TGACGTe. 5’-CCGUUAWhat is the correct order for the steps of transformation given inthe following list?1. Recombination with the bacterial chromosome2. Binding of a large DNA fragment to the surface of a bacterialcell3. Cutting a large DNA fragment into smaller pieces4. Uptake of DNA into the cytoplasm5. Degradation of one of the DNA strandsa. 1, 2, 3, 4, 5b. 2, 3, 5, 4, 1c. 2, 3, 4, 5, 1d. 2, 5, 4, 3, 1The following data is from the analysis of a circular piece of DNA (plasmid). A. Use this data to generate a circular map of the plasmid. Pst I: 10 kb Bam HI: 10 kb Sal I: 4.5, 3, 2.5 Sal I + Pst I: 4.5, 3, 2, 0.5 Pst I + Bam HI: 7, 3 Sal I + Bam HI: 4.5, 2.5, 2, 1 B. You have purified the 3 kb Pst I to Bam HI fragment of DNA and have labelled the DNA for use in a Southern blot. If the double cuts are shown were run on a gel, transferred to nitrocellulose, and then analyzed by probe hybridization; which band or bands from each double-cut would be identified?
- What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC-5 O 3- GCCTACGGGCATATG -5 O 5-GCCTACGGGCATAAG -3 O 5- GCCTACGGGCATATG-3 O3-CGGATGCCCGTATAC -5The chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction. The peaks are shown with shortest fragment on the left to longer fragments on the right. T •C A Select the DNA sequence that matches the data. 5-ТАТAСТТАСGAAGT-3' 5'-GTCCTACGGACGCG–3' 5'-ATATGAATGCTTCA–3' 5'-TGAAGCATTCATAT–3' 5-АСТТCGTAAGTATA-3'Use the set of gene sequencing results below to answer the question that follows: A G C T -Wells I 14. Based on the sequencing results above, what is the sequence of nucleotides as they were added by DNA polymerase to the DNA template? a/ATC-GCA-GTA b. TAG-TGC-CAT c. TAC-TGC-GAT GC-GA TAG-CGT-CAT L A EI la la اد ان YI
- Pictured below is a map of the pBR322 plasmid vector. If a DNA fragment is inserted into the Sal I site, what can be expected about the growth coli transformants containing the recombinant plasmid? EcoRI Pstl Ampicillin resistance (AmpⓇ) Origin of replication (ori) d. All of the above are true pBR322 (4,361 bp) Pvull BamHI Tetracycline resistance (TetⓇ) Sall a. The transformants should grow on nutrient agar containing ampicillin and tetracycline. b. The transformants should be able to grow on nutrient agar without antibiotics. c. The transformants should be able to grown on nutrient agar containing ampicillin1. You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions.a. PscI & GsuIb. ScaI, PdmI & BsaXI c.ScaI, SspI & EheIImage 1. Which 2 primers from the choices provided would work to amplify the DNA sequence given below ? 5’ACTGAGTCCATGCGATCATGACTAT 3’ 3’TGACTCAGGTACGCTAGTACTGATA 5’ this is a hypothetical example. In a real experiment Choose 5’ TGAC 3’ 5’ CTAT 3’ 5’ ACTG 3’ 5’ ATAG 3’ Image2. the template strand?The results of a gel-based sequencing experiment are shown below. What is the sequence, written Only include nucleotides (no spaces or numbers )
- 16. Which of the following enzyme repairs the DNA backbone during molecular cloning (that is you are inserting the DNA fragment into a plasmid and the bases in the sticky ends are aligned but the backbone needs to be repaired). a) reverse transcriptase b) restriction enzymes c) DNA ligase d) polymeraseTo amplify a section of DNA using the polymerase chain reaction (PCR), all you need to load into the tube is 1) a buffer solution, 2) the DNA you want to amplify, 3) some DNA nucleotides, 4) a polymerase (like Taq polymerase), and O an RNA polymerase a set of forward and reverse primers some phospholipids for a cell membrane some ribosomesYou have two PCR primers: Forward- 5' TGAGCTAGGC 3' and Reverse- 5' GGTTCAGTCAG 3'. Show the binding sites of the primers to their Double strand DNA template. As the primer sizes are 10 and 11 bp, just write a 30 bp double stranded DNA (making sure the 5' and 3' ends of the double strand DNA in all 4 ends) and show where in the 30 bp double stranded DNA, these two primers would bind in correct orientation.