Test for Unsaturation.   Reagent’s Composition   Observations: Test Samples Reaction with iodine   Coconut oil   Linseed oil Inferences: What is the principle behind this test?   Which of the test samples absorb more iodine? Why?

Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids:

A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Q: 3. Given the following peptide sequence, GSICDNCR, the estimated net charge at the given pH is: a)…

A: Peptides: Organic substances known as amino acids include both amino and carboxylic acid functional…

Q: Briefly describe the role of glycoproteins as antigenic determinants for blood groups.

A: Glycoproteins are proteins with carbohydrates attached to it. The carbohydrates that are commonly…

Q: Draw the pentapeptide REACH (one letter abbreviations) in the most prevalent ionization state at 8.4…

A: Recall that: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal…

Q: Triose phosphate isomerase In a key reaction of glycolysis, dihydroxyacetone phosphate (DHAP) is…

A: Given Values: ∆G°=7.5 kJ/mol or 7500 J/molT = 37°C or 310 KR = 8.314

Q: impact on the number of electron carriers used by the electron transport chain? Select one: The…

A: Introduction Cellular respiration is of two types: aerobic respiration and anaerobic respiration.…

Q: 8. Anaplerotic and amphibolic reactions in TCA.

A: In aerobic condition, pyruvate in the presence of pyruvate dehydrogenase complex produces Acetyl…

Q: 4) For the structure shown on the figure - qualitatively draw Ramachandran plot. Assume a mixture of…

A: Ramachandran plot is a 2-dimensional plot describing the allowed rotation in a protein. A protein…

Q: In biochemistry, what is definition of buffer , which amino acid can act as buffer? what is buffer…

A: The functioning of many molecules such as proteins, nucleic acids etc. depends on pH. The pH in…

Q: molecule with a hydrophilic end and a hydrophobic end

A: Molecules with a hydrophobic and hydrophilic end are known as amphipathic molecules. Such molecules…

Q: Identify the type of chemical reaction. 1 R R 2 Fat / Oil C01695 -R 3 NaOH/H₂O heat Lye Linoleic…

A: Triglycerides are fatty acid esters of glycerols. Fatty acids are carboxylic acids with a long…

Q: AMP is an activator of fructose 1,6-bisphosphatase (FBPase-1) True False

A: Glycolysis is the process by which one molecule of 6 carbon glucose is broken down into 2 molecules…

Q: 1a. Whats the difference between continuous and discontinuous synthesis? 1b. Why replication…

A: According to the semiconservative model of DNA replication proposed by Meselson and Stahl, each…

Q: As the leading scientist in a biomedical science laboratory, it is up to you to give advice to your…

A: Polymerase chain reaction or PCR s a method to obtained large number of copies of a target DNA…

Q: If a liver extract capable of carrying out normal metabolic reactions (including gluconeogenesis) is…

A: Gluconeogenesis is the metabolic pathway that converts non-carbohydrate metabolites like pyruvate…

Q: 4) For various amino acid pairs (for example: F to A, E to R, D to N, V to L, S to W), ask yourself:…

A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…

Q: 5. (a) Hexokinase IV is known as glucokinase (GCK) and is a central metabolic enzyme that…

A: Hexokinases: An enzyme that phosphorylates hexoses (six-carbon sugars) to produce hexose phosphate.…

Q: Imagine a disease that involves reduced expression of receptor X. There is no concentration of full…

A: In receptor-ligand interaction, the receptor is a macromolecule that serves as the binding site of…

Q: Use the table below to answer the question being asked: Protein Ovalbumin Insulin Fibrinogen…

A: Two dimensional (2D) polyacrylamide gel electrophoresis (2D PAGE) is a more powerful technique than…

Q: See the oligopeptide below. Compare the quantities of high energy molecules (e.g. ATP/ADP/AMP,…

A: Oligopeptides: It contains from two to twenty amino acids and may be made up of dipeptides,…

Q: What are the roles of sigma factor, rho factor, and an intrinsic terminator in transcription in…

A: Introduction: Transcription is the synthesis of single-stranded messenger RNA (mRNA) from the…

Q: Why is Hopkin's Cole test specific for tryptophan?

A: There are are biochemical tests that can be used for the detection of proteins and amino acids in a…

Q: What are the components of a nucleotide? Provide 1- or 2-sentence description of each component.

A: Nucleic acids are biomolecules that are essential for all life forms. They are polymers of…

Q: . Explain the assembly of an RNA Pol II basal transcription initiation complex.

A: Transcription is the synthesis of RNA from DNA that is the process of copying the information of a…

Q: Lactate dehydrogenase isoforms contain "H" and "M" subunits. In total, how many subunits are found…

A: - A dehydrogenase is an enzyme that transfers a hydride from one molecule to another. - Enzyme…

Q: xplain the indirect effect that allosteric effectors have on pyruvate dehydrogenase activity through…

A: The pyruvate dehydrogenase complex acts a a connection between glycolysis, the tricarboxylic acid…

Q: Provide the principle of each test used to detect the following substances. 17.    RNA: 18.…

A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Q: 4. Below each item, identify WHAT it is, indicate WHERE in the cell it is used/made (cytoplasm or…

A: Glycolysis is the metabolic pathway that converts glucose into pyruvate. The free energy that is…

Q: A student is trying to add 9.0 pmol of primer mix to a 20.0 µL PCR.  The primer mix is at a…

A: Equation of dilution: M1 × V1 = M2 × V2 where: • M1 is the molar concentration of the stock…

Q: Suppose there is a glycolytic-like pathway carried out by an alien species that uses analogous…

A: The reversible aldolase reaction in glycolytic pathway cleaves a 6 carbon keto-bisphosphate into a 3…

Q: 11. Use the data below to answer the following question: How much more energy is stored in a gram of…

A: Glycogen and fat are two molecules used by human body to store energy. The inside and even outside…

Q: What is ATP? in 5 sentences   Why is ATP important in the body? in 5-7 sentences

A: There are many forms of energy. But living system needs one form of energy i.e., chemical energy.…

Q: 1. Glucagon is a hormone that involves in the regulation of carbohydrate homeostasis.…

A: Proteins are made up of amino acid residues linked via a peptide bond. A peptide bond between two…

Q: Now use the equations above and the empirical values below to calculate VO₂ (the rate of oxygen…

A:

Q: 1. Why do proteins become polycations at extremely low pH and become polyanions at very high pH? 2.…

A: Proteins are biological macromolecules formed by monomers of amino acids. The amino acids have side…

Q: NH₂ Methyltransferases NH₂ OH OH S-Adenosylmethionine (SAM) Transamination B Phosphate transfer…

A: Methyl metabolism is well conserved across bacteria to humans. S-Adenosyl methionine (SAM) is…

Q: A student is trying to add 15.0 ng of DNA template to a 20.0 µL PCR.  The DNA template is at a…

A: Polymerase Chain Reaction or PCR is a method to make multiple copies of DNA starting from a small…

Q: 1. Deduce the primary structure of this polypeptide. 2. Why would cyanogen bromide not be a good…

A: a) Given the molecular weight of the peptide is 4000Average MW of an amino acid is 110 Da. So, the…

Q: 31. Margarine is made from vegetable oil by a chemical process. Do you suppose this process converts…

A: Margarine is a product derived from vegetable oil, obtained by the hydrogenation,…

Q: Draw his trp arg pro glu met ile | PH = 2 1b) How many possible structures are there for this? 1c)…

A: Peptides are composed of amino acids. Amino acids are biomolecules with an alpha carbon bonded to an…

Q: Wheeler Johnson Principle: Reagents: Reaction: Substance Detected: Murexide Principle: Reagents:…

A: DNA/RNA are nucleic acids, the molecules responsible for carrying genetic information from one…

Q: Give the isoelectric points of following 2 tripeptides DRI and RID.

A: pI (isoelectric point) of an amino acid is the PH at which the amino acid carries zero net charge. A…

Q: The following are importance of carbohydrates EXCEPT: O carbohydrates are non-polar molecules O…

A: Carbohydrates are polyhydroxy aldehydes or ketones.  Depending on their size, they can be…

Q: Consider the pyruvate carboxylase reaction, the first bypass step in gluconeogenesis: Pyruvate + CO₂…

A: Gluconeogenesis is a process by which cells make glucose from non carbohydrate sources.…

Q: 2. You made a pH=2.5 buffer solution by mixing NaOH and glycine to give a solution that is 0.20 M in…

A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…

Q: Suppose you have three polysaccharide samples, one of amylose, one of amylopectin, and one of…

A: Polysaccharides are the complex carbohydrates that are made up of monosaccharides joined by…

Q: RNA polymerase is found in the mitochondrial matrix.  True  False

A: The "powerhouses" of the cell are frequently referred to as mitochondria. They assist in converting…

Q: How can an understanding of enzymes and biological receptors guide medicinal chemists? Match the…

A: It was long recognized as a differentiating feature of both drug and receptor, the selectivity of…

Q: Test I. MULTIPLE CHOICE: Read the statement carefully. use CAPITAL letters. 1. It refers to the…

A: Note: Hi! Thank you for the question. We are authorized to answer one question at a time. Since you…

Q: In the free energy diagram below, molecule A (with energy x) is converted to molecule B (with energy…

A: Activation energy for a reaction is the minimum amount of extra energy that is necessary for the…

Stress

Stress is defined as the feeling of being overwhelmed or unable to cope with emotional or mental pressure. Any event or action that makes a person annoyed, furious, or nervous can trigger it. Chemical changes in the body caused by stress can cause blood pressure, blood sugar levels, and heart rate to rise.