Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting factors) Question: What are controversies or ethical dilemmas surrounding this genetic technology or process?
Q: Why are cell membranes disrupted by soap?
A: Please note that of the two unrelated questions posted together, the first one has been answered…
Q: Why is the davson Danielli model wrong?
A: The Davson–Danielli model also known as paucimolecular model of the plasma membrane was proposed in…
Q: with an optimal rate of malt sugar conversion during fermentation. You are provided with the…
A: Introduction Metagenomics is the study of a set of genetic material from a mixed community of…
Q: Describe the molecular genetics process using proper scientific terminology. Describe the steps that…
A: Molecular genetics has been proved to be revolutionary. From producing bulk drugs of animal origin…
Q: Affected people are usually born to unaffected parents. Parents of affected people are usually…
A: 1. Autosomal recessive 2 X linked dominant 3. X linked recessive 4. Y linked
Q: Imagine you are a cytogeneticist preparing a karyotype, but you forgot to add the colchicine in the…
A: The process of karyotyping occurs with the short-term culture of cells from the specimen. After a…
Q: Question 2 Describe how DNA polymerases achieve processivity in prokaryotes.
A: Introduction :- Prokaryotes are creatures without a nucleus or other organelles in their cells.…
Q: QUESTION 3: Why does a PCR reaction require a primer? composed of DNA or RNA? Would you expect this…
A: The polymerase chain reaction, or PCR, is a chemical reaction used by molecular biologists to…
Q: QUESTION NO. 1 Base excision repair A. is used only for bases that have been deaminated. B. uses…
A: Base excision repair (BER) corrects lesions in the base that don't significantly distort the DNA…
Q: In a hypothetical scenario, you wake up one morning to your roommate exclaiming about her sudden…
A: The features of cloning vectors are : 1. The size of the vector must not be too long. 2. the…
Q: Question 7 Referring to the plasmid below, if a recombinant plasmid were obtained by inserting DNA…
A: The plasmid is the extrachromosomal DNA present in prokaryotic organisms. They have the ability to…
Q: What is experiment of Thermodynamics of Small Oligomeric Duplex DNA Denaturation.
A: Double-stranded DNA is the most common kind of DNA molecule found in nature. The strands can be…
Q: Why is it necessary to chelate the metal ions from the solution during the boiling/lysis step at 100…
A: The polymerase chain reaction (PCR) is a fundamental biochemical method for exponentially…
Q: Question 47 The supercoiled DNA can either be positively or negatively supercoiled. A True в) False…
A: Proteins are an important class of biomolecules that are found in all living organisms and are…
Q: Imagine you are a cytogeneticist preparing a karyotype, but you forgot to add the Giemsa stain in…
A: G-banding, G banding or Giemsa banding is a technique used in cytogenetics to produce a visible…
Q: Question 1 During nucleic acid hybridization, the probe is labelled for DNA stability to increase…
A: Hybridization permits the distinguishing and cloning of explicit qualities, investigation of levels…
Q: When or why is this genetic technology/process used? Who benefits from this genetic…
A: Recombinant genetic technology is the process of combining nucleic acid (DNA) of two different…
Q: Select the letter of the most appropriate answer. - A. B. C.…
A: Hello, thank you for your question. One section has 11 points and the other has 14 points. So if it…
Q: Which of the following organism has the fastest rate of renaturation of genome DNA? Question…
A: Option a
Q: Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting…
A: The recombinant DNA technology (cloning) is used for the production of insulin, growth hormone (GH),…
Q: Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting…
A: A hormone is a chemical messenger.
Q: How did you select and grow a streptomycin resistant strain of bacteria in this experiment? 1. A…
A: In a bacterial Colony some genes are antibiotic resistant and by conjugation these transmit their…
Q: Question 3 Choose the false statement below. O CRISPR is a protein complex which causes the…
A: "Biotechnology" is the use of our knowledge of biological processes to the development of beneficial…
Q: Explanation of why mutations vary in likelihood of causing disease depending on location relative to…
A: Phenylketonuria is caused due to a genetic mutation in the PAH gene( phenylalanine hydroxylase…
Q: Question 2. It is your first week working in the lab but unfortunately you program the PCR machine…
A: PCR is also called as polymerase chain reaction which has the ability to make millions to billions…
Q: Question 7 Referring to the plasmid below, if a recombinant plasmid were obtained by inserting DNA…
A: A plasmid is a small, circular, double-stranded DNA molecule that is distinct from a cell's…
Q: Which of the following methods can be used to compare the amounts of one specific mRNA that is…
A: A. Immunohistochemistry Deals with the measurement/determination of the distribution of an antigen…
Q: QUESTION 1 Match the discovery with the individual or groups that discovered it. (names may be used…
A: Introduction DNA:- It is a long molecule that contains our unique genetic code, It transmits the…
Q: Please answer these two questions regarding PCR: a) Why do you need to perform PCR on DNA obtained…
A: The polymerase chain reaction (PCR) is a technique used to make many copies of a specific segment of…
Q: Question- There are 2x10-3 mutations in every replication of a given strain of bacteria, and this…
A: Given information Number of mutations in one replication - 2x10-3 Time for one replication is = 30…
Q: QUESTION 5 Imagine that you have cloned the gene encoding the SARS-CoV-2 spike protein to a plasmid…
A: DNA cloning is the process of making multiple, identical copies of a particular piece of DNA. In DNA…
Q: Question 5: Try cutting Plasmid 1 with Xhol. Xbal. Kpnl, and Pstl. Try cutting with all 4 together.…
A:
Q: Which of the following organism has the fastest rate of renaturation of genome DNA? Please explain…
A: DNA is the nucleic acid present in the cells of living beings.
Q: Question 1 Why do you think scientists track the genes of other organisms such as rats or mice in…
A: Genetic research deals with the study of genes that are involved in the progression or development…
Q: Topic: Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood…
A: With the advent of biotechnology and genetic engineering, several achievements have been made in…
Q: Part A Why are most recombinant human proteins produced in animal or plant hosts instead of…
A: Bacteria is a prokaryote and human cells are eukaryotic. There is a significant difference in the…
Q: Question 1 A T What is the sequence of the sample DNA submitted for sequencing given the gel…
A: The unknown DNA samples can be sequenced by the Sanger sequencing method. This method is based on…
Q: Question 5 Match the following components with the biotechnology technique they play a role in.…
A: Recombinant DNA technology is a technique by which foreign DNA is introduced into the host. DNA…
Q: The full set of different transcripts expressed by a cell is called Question 16 options:…
A: Each cell of biological entity has an unique profile of ribonucleic acid (RNA) expression.
Q: What is one use of recombinant DNA? Choose all that are correct. Group of answer choices genetically…
A: First lets see what recombinant DNA is ? We know DNA molecules are present in nucleus which…
Q: A description of the principles of agarose gel electrophoresis of DNA.
A: INTRODUCTION:- Gel electrophoresis separates DNA on the basis of its charge and size in a solid…
Q: question on plasmid minipreps and restriction digestion How does this procedure allow you to purify…
A: Plasmids are extrachromosomal circular molecules of double stranded DNA which can replicate…
Q: Question 33 Which of these genes would be on the bacterial chromosome, rather than on a plasmid In…
A: Bacterial chromosomes are located in a nucleotide, a distinct cytoplasmic structure in which double…
Q: QUESTION 12 This experiment used radilobeled T4 phage to determine the genetic material. a. Pavlov's…
A: The viruses that infect bacteria are called bacteriophages. Bacteriophages are also known to infect…
Q: Whole genome sequencing provides the most comprehensive genomic information. Nevertheless, there are…
A: DNA microarrays are a set of DNA probes that are arrayed on a solid platform and used to detect the…
Q: QUESTION 4: Should PCR primers be complementary to each other?
A: Answer 4-:PCR primers should be complementary to the strands of DNA rather than complementary to…
Q: Which of the following statements regarding ionizing radiation is FALSE? Question options:…
A: Electromagnetic waves are waves with both particle and wave nature. They are produced by vibrations…
Q: Question 13 Zinc finger nuclease is a Gene editing tool: 图 which uses a site-specific endonucleases…
A: Zinc finger nuclease is an artificial restriction enzyme generated by the fusion of zinc associated…
Step by step
Solved in 3 steps
- Topic: Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting factors) Question What are the drawbacks/disadvantages/unknowns associated with this genetic process?Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting factors) Question: Provide an additional fun or interesting fact about the process.Topic: Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting factors) Question Describe the molecular genetics process using proper scientific terminology. Describe the steps that are involved. How is it performed?
- QUESTION:- Whole genome sequencing provides the most comprehensive genomic information. Nevertheless, there are many instances when microarrays or limited sequencing of a selected panel of genes are the approaches chosen for clinical use , Why?Question:- Is DNA sequencing a in vivo, in vitro and/or in silico? What product(s) is/are formed in DNA sequencing and how and where would the reaction begin? Also, what raw materials are needed?Question one: PCR You want to amplify the underlined sequence, 1) Design Forward and Reverse primers to do so 2) Calculate the melting temperature for them 3) Calculate annealing temperature for them 4) Do you think your primers are high quality (Length, differences in melting between R and F, possibility of forming hairpins)? GTGTGCTGGTTATTCAAACAGATAAAAAAATTAAT CTATATGGTAATGCTCTAAGCCGCGCAAATACAG AATATGTGCCAGCCTCTACATTTAAAATGTTGAAT GCCCTGATCGGATTGGAGAACCAGAAAACGGATA TTAATGAAATATTTAAATGGAAGGGCGAGAAAAG GTCATTTACCGCTTGGGAAAAAGACATGAСАСТА GGAGAAGCCATGAAGCTTTCTGCAGTOCCCAGTCT ATCAGGAACTTGCGCGACGTATCGGTCTTGATCT CATGCAAAAAGAAGTAAAACGTATTGGTTTCGGTA ATGCTGAAATTGGACAGCAGGTTGATAATTTCTG GTTGGTAGGACCATTAAAGGTTACGCCTATTCAA GAGGTAGAGTTTGTTTCCCAATTAGCACATACACA GCTTCCATTTAGTGAAAAAGTGCAGGCTAATGTAA AAAATATGCTTCTTTTAGAAGAGAGTAATGGCTAC AAAATTTTTGGAAAGACTGGTTGGGCAATGGATAT AAAACCACAAGTGGGCTGGTTGACCGGCTGGGTT GAG
- Which of the following statements regarding mutation is FALSE? Question options: mutations can be caused by certain environmental agents ALL of these statements are TRUE mutations are usually lethal to the organism mutations in somatic ells of multicellular organisms are not passed to offspring through sexual reproduction mutations typically occur during the production or repair of DNA mutations in bacteria are passed to daughter cells Question 3 A(n) _________ mutation involves the substitution of one purine for another purine. Question options: frameshift transversion transduction translocation transformation transitionQuestion 25 What is a major drawback of performing genome editing with site-specific endonucleases over RNA-guided endonucleases? difficulty in transformation Necessity of protein cargo to facilitate the editing the need to genetically engineer a new endonuclease for each target sequence. Specificity is not achieved Question 35 Identify the disease: Affected people are usually born to unaffected parents. Parents of affected people are usually asymptomatic carriers. It affects either sex. After the birth of an affected child, each subsequent child has a 25% chance of being affected (assuming that both parents are heterozygous carriers). X-linked dominant Autosomal recessive Y-linked X-linked recessive Question 36 Using Sanger sequencing, starting from the sequencing primer, what is the sequence of the DNA sample ? Question 36 options: G T A C C C G A A A T C A G G A A G…Question 5. You are interpreting data on a DNA chip, or microarray. You expose the chip to a mixture of two CDNA populations: one from cells that were not treated with a glucocorticoid hormone (untreated controls; labeled with a red fluorescent dye) and a population from cells that were treated with glucocorticoid hormones (glucocorticoid-treated; labeled with green fluorescent dye). You look at a spot on the chip representing the gene for phosphofructokinase, a gene that is not affected by glucocorticoid treatment, but is instead expressed in all cells. What color should the spot representing the phosphofructokinase gene be?
- QUESTION 3: Why does a PCR reaction require a primer? Would you expect this primer to be composed of DNA or RNA?Question 2. Retroviruses are used in gene therapy. The goal of gene therapy is to insert in the patient genome a copy of a functional gene that is defective in the patient. Since Retroviruses integrates their genome into the host genome they are ideal gene therapy delivery systems. What would be a potential risk of this type of treatment? The individual treated could be more susceptible to infection by other retroviruses Insertion of the retroviral genome into the host genome can cause dangerous mutations. There are not recognized risks with this gene therapy approach. Genes from the host can be inserted into the retroviruses and laterally moved to other cells.QUESTION 4: Why does a PCR reaction require a primer? Would you expect this primer to be composed of DNA or RNA? Explain your reasoning.