Q: he red-vented bulbul (bird) is famous and almost unique amongst animals because it does not make its…
A: The ed-vented bulbul is famous and unique among animals because it does not make its own vitamin C.…
Q: Produce a Punnett square to illustrate the dihybrid cross described below: There are two common…
A: A dihybrid cross is a cross in which two traits are involved According to question , two traits…
Q: What is missense, and frameshift mutations potential impacts on gene function and organismal…
A: Mutation describes an abrupt shift in a gene's features. DNA changes are referred to as mutations.…
Q: Which best explains the expected role of natural selection in this scenario? Group of answer…
A: As a kind of evolution, natural selection works. More environmental adaptation increases an…
Q: Create a professional and compassionate response (based on the science learned in this class) to…
A: Here we will address concerns regarding the timing of vaccinations and the potential risks of…
Q: Based on the diagram, which sentence BEST describes this organism? A. It is a prokaryote that…
A: R. H. Whittaker divided organisms into five kingdoms. These are Monera, protista, fungi, plantae and…
Q: Recipient Recipient leu- phe+ his met+ tyr+ leu- phe+ his+ met- tyr+ leu- phe+ his+ met+ tyr- leu-…
A: Bacteria commonly use the three horizontal gene transfer methods of transformation, transduction,…
Q: Is there evidence that genes may become expressed that contribute to obesity?
A: Obesity is a medical condition characterized by the excessive accumulation of body fat to the point…
Q: Herpes virus has the ability to go dormant inside of host cells. Explain why antibodies alone would…
A: A DNA virus is a type of virus that contains genetic material in the form of double-stranded DNA…
Q: A cancer that affected the bone marrow would NOT affect which of the following cell populations? O…
A: All of the listed cell populations would be affected if cancer affected the bone marrow.
Q: Discuss the history of epidemiology.
A: Epidemiology is the study of the distribution and determinants of health-related states or events in…
Q: D Question 5 How are SNP's related to alcohol metabolism? SNP is a type of alcohol dehydrogenase. O…
A: SNP, or single nucleotide polymorphism, is a frequent form of genetic diversity that happens when a…
Q: plz discussed the following Prevention (Corona) Vaccine therapeutics and Drugs (Corona) Current…
A: The SARS-CoV-2 virus, also known as the coronavirus or COVID-19 is responsible for the extremely…
Q: How an algal cell is different from fungal cells, even if both are eukaryotes? Why slime mold is a…
A: Algal cell is different from fungal cells:- Algal cells are different from fungal cells, even if…
Q: Where will the proteins synthesize at the cytosol of a cell and the endoplasmic reticulum or mRNA?
A: Protein synthesis is the process by which cells build proteins using the genetic information encoded…
Q: The per capita growth rate of the Colorado River fish is 27.0. The change in the size of the…
A: The full equation for yearly per capita rate of growth is as follows: CGR=((G / N) * 100) / t Here,…
Q: Considering only the five genes A, B, C, D, and E, how many genetically distinct gametes (i.e.…
A: An individual with the genotype AABbCcDDEe, where each letter stands for an allele for five distinct…
Q: The electrochemical gradient across membranes is important in determining movement across membranes…
A: The electrical potential difference arises due to the separation of charges across the membrane,…
Q: Last year 68 year old Juana received her influenza vaccination and two days later she showed all the…
A: Vaccines are biological products that help to stimulate the bodys immune system to build protection…
Q: What is the purpose of the underlined sequence? 5’ CAGGGTAGGTACTATGCCTGGATGCCATGGGTAAGGACTAATAAAG…
A: In molecular biology, understanding the purpose of specific nucleotide sequences is crucial for…
Q: Lipid bilayers are said to behave like two-dimensional fluids. What does this mean? What drives the…
A: Lipid bilayers are the basic structural components of cell membranes & are composed of a double…
Q: A tRNA that could “read” the 5’ GAA codon of glutamic acid would have the anticodon: Answer choices…
A: Transfer RNA (tRNA) is a type of RNA molecule that plays a crucial role in protein synthesis by…
Q: Which one of the following concerning the genetically modified purple tomato is correct? It was…
A: GMO stands for genetically modified organism. It refers to any organism, such as plants, animals, or…
Q: What is in common between Epinephrine-secreting cells of the Adrenal Medulla gland and…
A: A neural crest is a collection of certain cells that develops at the edge of the neural plate…
Q: DNA synthesis
A: DNA: It is deoxyribonucleic acid which is a double-stranded nucleic acid which contains genetic…
Q: Explain the process of exfoliation, and under what conditions it occurs.
A: Exfoliation, in general, indicates the removal or shedding off of layers. It can happens in rocks,…
Q: Translate to amino acids the strand using the Genetic Code chart. Remember to use the start and stop…
A: mRNA or messenger RNA contain the genetic codons that must be translated into amino acid chain…
Q: briefly describe one similarity and one difference between MCH and Orexin?
A: Sleep is a condition of diminished physical and mental activity during which consciousness is…
Q: Match the following structures to their corresponding tissue type. Cuticle Cortex Phloem Pith…
A: Plants are made up of several tissues that perform various roles to promote their growth,…
Q: Answer the questions below to help you write your case summary. 2. Use the scroll bar on the right…
A: Kidney failure is also known as renal failure which can be diagnosed through a combination of…
Q: Write an outline persuasive speech about "Fasting" and convince the audience to believe and get the…
A: During fasting, the body undergoes a metabolic shift, utilizing stored fat for energy instead of…
Q: Describe at least one mechanism that exists to switch off a signal after a signal transduction has…
A: Transduction is the process by which a cell or organism converts one form of energy or signal into…
Q: Has mutated terminal sequences and lacks a functional transposase or reverse transcriptase. Has…
A: Transposable elements (TEs) are DNA or RNA sequences that have the ability to relocate within a…
Q: A population of Giant armadillo, an endangered species found in South America, increased in numbers…
A: Per capita growth rate refers to the rate at which a population grows or changes on a per capita or…
Q: 23. Which muscle attaches to the medial aspect of the mandibular ramus near the angle?
A: A muscle is a type of tissue in the body that is responsible for producing movement and maintaining…
Q: What is the most likely inheritance pattern shown in image B, below? A KEY Homozygous Homozygous…
A: Inheritance pattern is a type of pattern which evaluates how traits are passed from parents…
Q: The whooping crane is on Canada’s Endangered Species list and is protected in some national parks. A…
A: Population growth is the change in the number of individuals in a population over a specific period…
Q: 9. There is a negative correlation between the sleep patterns of owls and humans: owls are more…
A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…
Q: Which describes the correct sequence of steps of protein synthesis? Group of answer choices The DNA…
A: Protein synthesis is a complex process that involves the translation of genetic information into…
Q: Question 8. Your DNA sample concentration is 2 µg /μl, and you want to add 4 µg of your DNA to 150…
A: To add 4 µg of DNA to 150 µl of TE buffer, we need to calculate the volume of DNA needed. We can use…
Q: Which of the following would best describe the relationship between the medial geniculate nucleus of…
A: The thalamus is a primary brain relay centre that receives and transmits sensory information to…
Q: Question 8. Your DNA sample concentration is 2 µg /μl, and you want to add 4 µg of your DNA to 150…
A: TE buffer is a commonly used buffer solution in molecular biology that contains Tris-HCl and EDTA.…
Q: d) RNA Seq is used to determine off-target effects of Cas9 cleavage. Why is this an appropriate tool…
A: The ground-breaking gene-editing tool CRISPR-Cas9 has quickly established itself as an essential…
Q: Give typing answer with explanation and conclusion Which of the following is NOT a direct function…
A: Eukaryotic cells have a network of protein filaments called the cytoskeleton that supports their…
Q: Could somone explain exactly what this means below? NOT HW just trying to get a better understanding…
A: To produce mice that are deficient for RAC1 in macrophages, female C57BL/6 mice homozygously…
Q: 4) What is the significance of colonies that develop within otherwise clear zones of inhibition? If…
A: Antibiotic susceptibility testing, such as the Kirby-Bauer disk diffusion test, plays a crucial role…
Q: To study the genetics of flowering time in Brassica rapa (i.e. the number of days from germination…
A: The species of Brassica rapa, which belongs to the Brassicaceae family, is a crucial model organism…
Q: Give typing answer with explanation and conclusion 13. Which of the following best describes the…
A: Chimps is a common shorthand term used to refer to chimpanzees, which are a species of great ape…
Q: Give an example of a secondary active transport event that results from the primary active…
A: Sodium-potassium pump is a transporter protein in which three molecules of sodium ion are pumped out…
Q: 1.Explain how Toxoplasma gondii is the most successful parasite in the world. Explain the roles of…
A: A primary host is the organism that a parasite or other organism needs to reach sexual maturity and…
Step by step
Solved in 3 steps
- 1. Please discuss how the Methyl Red-Vogues Proskauer test help distinguish microbes from each other.1. Describe the three different type of hemolysis that are observed on blood agar.2. What is a selective medium?3. What is a differential medium?4. Which media can be used to isolate E. coli samples from contaminated lettuce?5. Which two media would be used to identify a sample taken from a patient with suspected gonorrhea?6. Would you be able to grow a sample obtained from a patient's wound (suspected to be infected with MRSA) on EMB? Explain.7. What is the color or TSI for Salmonella?8. What is a fastidious organism?Ex. 17: Chemotherapeutic Agents Using the Antimicrobial Susceptibility Table on pg 62 in the lab manual, determine whether not the bacteria plated in this Kirby-Bauer test are resistant (R), intermediate (I), or susceptible (S). The bacterial species tested was Escherichia coli (Gram negative). Ciprofloxacin Diameter = 20 Streptomycin Diameter 30 Carbenicillin Diameter 17 + Erythromycin Diameter = 23 Novobiocin Diameter = 0 bacterial growth = disk with antibiotic (see labels) = no growth
- 1. What is the critical threshold between bacterial infection and simple bacterial contamination? 2. Why is aseptic technique important in urine collection? 3. Give at least 5 bacteria that can cause Urinary Tract Infection.1. Answer the following questions A. What is the antimicrobial mode of action in the antimicrobial assay? B. Based on the results, interpret the efficacy on the test organism?4. After incubation of the mating mixture for 1 hour, prepare a serial dilution of the mating mixture in sterile saline (to 103). As described in step 2, clearly label each of the double selective agar plates (i.e. (i) Nutrient agar+ Ap + Rif, (ii) Nutrient agar+ Sm + Rif) AND iii) the Nutrient agar + Ap + Sm + Rif plate. Spot inoculate 3 x 10 µl drops of the undiluted, 10-1, 10-2 and 10-3 dilutions of the mating mix onto quadrants of each of these plates. • What is the purpose of this step?
- 1. how does colony appearance and location with respect to the agar differ on the spread and pour plate? 2. list two additional factors that contribute to error in the spread plate method:You perform a Kirby-Bauer assay with two antibiotics. Antibiotic X has a zone of inhibition of 9 mm. Antibiotic Y has a zone of inhibition of 11 mm. Which antibiotic is better at killing this particular microorganism? Group of answer choices 1Antibiotic Y 2Antibiotic X and Y, which have identical antimicrobial activities 3Antibiotic X4 4It is impossible to tell from the information given1. How is UV radiation a good type of control mechanism against microbial growth? Please explain what happens to the microbe and effects this control causes. 2. Suppose you do the Kirby-Bauer test on a hypothetical Staphylococcus species with penicillin and tetracycline. You record diameters of 20mm for tetracycline and 24mm for penicillin. Which antibiotic is most effective against this bacterium and why? Please explain and interpret these results. 3. Please provide the scientific name of your microbe that was used in the UV experiment (i.e. S. aureus). Compare your plates and interpret/analyze your results. Please discuss your findings and any patterns you were able to gather. 4. After performing the “Effects of Antiseptics & Disinfectants” lab which agent(s) showed potential to control S. marcescens growth? P. aeruginosa? Please explain why you believe these agent(s) work. 5. What purpose does water serve in the “Effects of Antiseptics & Disinfectants” lab? What did you…
- 1. How is UV radiation a good type of control mechanism against microbial growth? Please explain what happens to the microbe and effects this control causes. 2. Suppose you do the Kirby-Bauer test on a hypothetical Staphylococcus species with penicillin and tetracycline. You record diameters of 20mm for tetracycline and 24mm for penicillin. Which antibiotic is most effective against this bacterium and why? Please explain and interpret these results.1.What are the limitations of using an agar disk diffusion assay to assess the effectiveness of an antiseptic, disinfectant, or, in this case, a biological control agent on the growth of bacteria of interest? 2.LAB produce organic acids that have shown to be effective against controlling the growth of foodborne pathogens. What specific organic acid is produced by LAB during fermentation? 3.What is the logical next step to validate the efficacy of the biological control agent?1. Give 2 systems used at present for the automatic identification of bacteria. 2. Why aseptic technique important in urine collection for culture? 3. What are the specimen consideration you have to remember in preparing blood culture? 4. Being a medical technology student, how can you contribute to avoid water pollution and degradation of natural resources?