Q1.(Shown below is the structure of a Drosophila gene, divided into 10segments, designated A-J. The gene contains three exons, two introns, a promoter, and asite in I for poly(A) addition.Exon 1Exon 2Exon 3PromoterIntron 1Intron 2AATAAAвCDE FG|Ha) What segment or segments of the gene will be represented in theinitial RNA transcript (primary RNA)? List the appropriate letter orletters.b) What segment or segments of the gene will be found in the completelyprocessed transcript (mature RNA)?c) What segment or segments of the gene in the processed transcript willhave additional nucleotides added to them?d) If the segment... . is methylated, this could block thetranscription's initiation as RNA polymerase will not be able to bindto this segment.

The two steps of gene expression are transcription and translation. After transcription, the primary…

Answered: Q1. (Shown below is the structure of a…

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter16: Regulation Of Gene Expression

Section: Chapter Questions

Problem 10TYK

See similar textbooks

Similar questions

GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
+1 1 2 4 6. 7 8. 9. Transcriptional stop sequence ТАTА box ATG ТА AUG UAA Here is a diagram of a human gene in the genome. The bar above it is indicating different regions of the gene sequence. 7. Which region or regions contain the sequences that direct splicing? - 8. In which region or regions could a single base pair insertion cause a frameshift mutation (but not because of changed splicing)? - 9. In which region or regions might you find sequences that control the amount of transcription of this gene? + 10. In which region or regions could a single base pair deletion cause the mRNA to be one base pair shorter? - 11. Which region or regions usually contain a sequence that controls the secretion of the protein e product? e
I. The retinoic acid receptor (RAR) is a transcription factor that is similar to steroid hormone receptors. Thesubstance (ligand) that binds to this receptor is retinoicacid. One of the genes whose transcription is activatedby retinoic acid binding to the receptor is myoD. Thediagram that follows shows a schematic view of theRAR proteins produced by genes into which one oftwo different 12-base double-stranded oligonucleotides had been inserted in the ORF. The insertion site(a–m) associated with each mutant protein is indicatedwith the appropriate letter on the polypeptide map.For constructs encoding proteins a–e, oligonucleotide 1(5′ TTAATTAATTAA 3′ read off either strand) wasinserted into the RAR gene. For constructs encoding proteins f–m, oligonucleotide 2 (5′ CCGGCCGGCCGG 3′)was inserted into the gene.NH2 f g h i j k l m COOHa b c d eThe wild-type RAR protein can both bind DNA and activate transcription weakly in the absence of retinoic acid(RA) and strongly in RA’s presence. Each…
IPSCs are nearly identical to human embryonic stem cells in terms of gene expression, but there may be other ways in which they are not equivalent. For example, the telomeres of IPSCs often vary in length, with many IPSCs cells having telomeres shorter than those of embryonic. How might shortened telomeres affect the life-span of IPSCs or of differentiated cells derived from them?
a. How can a single eukaryotic gene give rise to several different types of mRNA molecules?b. Excluding the possible rare polycistronic message,how can a single mRNA molecule in a eukaryoticcell produce proteins with different activities?
he Drosophila oocyte/embryos A-F show the expression patterns of various mRNAs. Which is the distribution of the hairy mRNA? A B C D E F
5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene
The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.
11.5 A A Aa-AE-E-¹5- U - abe X₂ X² A-ay-A- Font Ulla Unigriffin DNA: mRNA: amino acids: traits: DNA: traits: mRNA: amino acids: · DNA: mRNA: to search #N O E Et CE- Paragraph $ 15 Ser 1. CAT AGG GAG | CAA GGG TGA CTT TTT | AAT AAT GAC GGG | A E ALT | CAA TTG TTA CGG | AAA AGA CCC | GCC ATA ACA TTT | % STP | CAC CGT CGA | GTA GTA | AGA GGG CAT | TTG TAA GGA GGG GGG TGT | 16 AaBbCcDc AaBbCcl AaBbCcL Aa BbCcDc 1 Normal 1 Body Text 1 List Para... 1 No Spac... W] Tyr 17 Val & 7 Gly E CO OM no num lk T Aa Bb Cc 1 Table Pa (p)) Styles 12 P
e B 1_30*_SP23 - General Biology I (for majors)/11364 of € 2 A us page X F1 What conditions would we find on the gene of a prokaryote if there is low amounts of tryptophan within the cytoplasm? Select one: a. lactose would attach to the repressor removing it from the promoter promoting the transcription of lactase b. no repressor is on the promoter creating constant transcription of lactase c. tryptophan would attach to the repressor removing it from the promoter promoting the transcription of lactase O d. repressors would bind to the promoter stopping the transcription of lactase e. lactose would attach to the repressor removing it from the promoter promoting the transcription of tryptophan producing enzymes no repressor is on the promoter creating constant transcription of tryptophan producing enzymes tryptophan would attach to the repressor binding it to the promoter and stopping the transcription of tryptophan producing enzymes O f. O g. 2 Oh. tryptophan would attach to the…
b. Which one of the following a cell mutants will be able to switch at least once? [Select]

SEE MORE QUESTIONS

Recommended textbooks for you

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781305073951

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781305073951

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS