Q: 26. Directions: 1st Fill in the complimentary DNA strand using DNA base pairing rules. 2nd Fill in…
A: Reverse transcriptase, a DNA polymerase which can use either DNA or RNA as a templates, creates…
Q: A Moving to another question will save this response. Question 7 All plants exhibit alternation of…
A: Introduction :- In plants and algae, the alternation of generations is the most common type of life…
Q: Linear evolution suggests that there is a ladder, or step- progression, to evolution over time one…
A: The pre-Darwinian theories established by Aristotle, when species were believed to be static…
Q: GAT C |||||||| ||||| | || | | || | || | || a.) What is the base sequence of the sample ssDNA? b.) If…
A: NUCLEOTIDE SEQUENCING: The process of determining the order of nucleotides in a genome is known as…
Q: If you had nucleotide sequences from virus particles from two infected hosts, could you estimate how…
A: Introduction We can be infected by various microorganisms like bacteria, viruses, fungi. Once a…
Q: 3 ways in which carbon dioxide is transported by the renal vein
A: Cell metabolism in the mitochondria results in the production of carbon dioxide. The output is…
Q: ermine the use of metagenomics to discover new pathogens and create antibiotics to eliminate them.
A: Antimicrobials are chemicals or substances that either stop bacteria from growing or actually kill…
Q: Enzymes work by at least three mechanisms. Which of the following is NOT a mechanism by which…
A: Introduction Enzymes are the molecules that catalyse biochemical reactions, while a catalyst is a…
Q: During meiosis in male mammals, sex chromosomes segregate to produce two types of sperm: X‑bearing…
A: In mammals sex determination is male heterogametic type in which the male produces two types of…
Q: Why is Zoology considered a science keep the answer simple
A: Zoology is the branch of biology that studies the animal kingdom.
Q: Analysis the features of a maize plant and classify it into the appropriate plant group
A: Plants are classified into different groups based on their features. The two main groups of plants…
Q: Sperm use B is released and a in the uterus. to breakdown the outer coating of the egg, and once the…
A: Developmental biology is the branch of biology that studies how several interrelated mechanisms…
Q: HOTS 21 Which food is more nutritious-cornflakes milk, or plain noodles?
A: Food includes the substances that we eat to obtain nutrients.
Q: Question 33 (1 point) ✓ Saved Which of the following reactions is catalyzed by carbonic anhydrase?…
A:
Q: Explain the principles of the redox code. Distinguish between redox switches and redox sensors.
A: Biological systems follow a redox code that defines how nicotinamide adenine dinucleotide (NAD,…
Q: You are hired by an elementary school to improve the physical activity programming for all students.…
A: DISCLAIMER FOR MULTIPART Since you have posted a question with multiple sub-parts, we will solve…
Q: 4. What is the role of the diaphragm in the respiratory system? How does it work during inhalation…
A: The movement of oxygen from the outside environment to the cells within tissues, as well as the…
Q: What kingdom monera
A: Introduction: Animal, plant, fungus, protist, and monera are the five kingdoms that make up the…
Q: IV. OTHERS: Answer the test cross problem below. Show your solution in a Punnett square. 1-5. A…
A: A test cross is an experimental cross of an individual organism of dominant phenotype but unknown…
Q: What are the adaptations of the phloem cell?
A: Introduction Plants need a continuous supply of water and nutrients for their survival and growth.…
Q: Why are cells small
A: Introduction Cells are the basic fundamental unit of life. All the organisms are made up of cells.…
Q: what is the lung cancer sample collection
A: Introduction Cancer is a lifestyle disease which can be caused by abnormal or unhealthy lifestyle…
Q: How does aging affect blood pressure? Is advanced age considered a barrier to aggressive…
A: Aging:- it is a process of progressive deterioration that causes reduction in physiological…
Q: To see the entire chart, please click on it with your cursor and click the right arrow key several…
A: How are organisms classified according to hierarchy? Each of these levels of the hierarchy is called…
Q: DNA contains genetic code that determines... Ophysical traits O unobservable traits Ohow smart you…
A: DNA or deoxy ribo nucleic acid is main genetic material within eukaryotes such as humans. Their…
Q: Mosses are small plants that produce spores and need a damp place to live. A. True B. False…
A: Introduction :- Certain fungi, plants (moss, ferns), and bacteria create spores, which are cells.…
Q: Stage 1 Digestion Stage 2 Catabolism to Smaller molecules Urea Stage 3 Oxidation to CO2, H₂O and…
A: The given question provides some biochemical processes/pathways in the metabolism of proteins,…
Q: What causes plants to burn easily?
A: Leaf scorch (also known as leaf burn, leaf wilt, and sun scorch) It is characterised by browning of…
Q: Question 1 Which structure is correctly paired with its tissue system? root hair-vascular tissue…
A: Vascular tissues are complex conducting tissues in higher plants made up of various cell and element…
Q: Determine the correspondence of the gene X and gene Y to the mutant gene causing Trp-phenotype
A: An organism's genotype is influenced by its genome as well as by its environment. The physical…
Q: Make me frameshift mutation
A: Any heritable alterations to the DNA sequence are known as mutations. Nucleotide substitution…
Q: Recognize the following types of biomolecules when given images such as the ones below and on the…
A: Upper lane 1st image: Phospholipids 2nd image: amino acid 3rd image: glucose(which is a…
Q: A method which can prevent oral purge when shipping by air is to___. ligate the trachea keep a…
A: Introduction The lungs are two paired structures involved in respiration. They are situated in the…
Q: 7 10 P Required HOW ARE PROTEINS MADE? STEP 1: mRNA strands are select.... the select.....…
A: Translation is a process by which cell makes proteins using genetic information carried in mRNA. It…
Q: explain synaptic plasticity and neurophysiological changes to the mesolimbic system that occur…
A: Addiction was formerly thought of as a personal decision rather than a sickness. Finding effective…
Q: Nitrogen fixation is the reaction of: conversion of gaseous N2 into a biologically useful form of…
A: Q. Nitrogen fixation is the reaction of: a)conversion of gaseous N2 into a biologically useful form…
Q: what is the genotype of a pure breeding myopic person
A: Myopia is also known as short-sightedness which is a hereditary disorder. In this type of hereditary…
Q: Solve the following problem: 34,000 bacteria/l have been measured 4 hours after inoculating a…
A: Given information Bacterial population after 4 hours of inoculation= 34,000 bacteria/l Bacterial…
Q: Compare the number and type of chambers found in fish, toad and human hearts – how do they differ?…
A: Humans and the majority of other animals depend on their hearts to stay alive. Examining the…
Q: An organism in a Domain also belongs to the same class. Select one: True False
A: Introduction: A single live entity is referred to as an organism. A living item is easy to observe,…
Q: What evidence supports the hypothesis that mitochondria preceded plastids in the evolution of…
A: Introduction Evolution is the key process that regulates the survivability and continuity of species…
Q: Which of the following factors stabilizes population growth into an S-shaped curve? a. limited…
A: Increases in a population's or a dispersed group's membership are referred to as population growth.…
Q: How can homologous recombination affect genome evolution in bacteria? Describe at least TWO…
A: Introduction : The gene combination which is different from parental genes is called recombination.…
Q: 30. Transport media functions to maintain the microorganisms 31. The proper way to store…
A: Introduction A microbiological culture, also known as a microbial culture, is a technique for…
Q: Give the importance of heating as a laboratory technique
A: Heating is an important laboratory technique because it can be used to accelerate chemical…
Q: Rubisco requires a bound CO2 for catalytic activity. What happens with rubisco when CO2 is bound?…
A: A crucial enzyme in photosynthesis, Ribulose Bisphosphate Carboxylase/Oxygenase (Rubisco), is…
Q: Starting with one double-stranded DNA, what is the total number of double-stranded DNA after 5…
A: PCR (polymerase chain reaction):- it is a mechanism to amplify the segment of DNA into millions or…
Q: What is scientific consensus
A: Basically, a consensus defines a general agreement on a particular subject or matter. A example of…
Q: 2 3 4
A: When when a growth of particular Organism or population is recorded and represented in graphical…
Q: How would pyrimidine dimers from the sun effect replication of this gene sequence?…
A: Pyrimidine dimers are the dimers formed between two pyrimidine molecules. Usually it forms between…
Step by step
Solved in 2 steps with 1 images
- Answer the following problems for genetic code and protein synthesis. 1. Translate the following mRNA into protein: mRNA: 5’ AUG CCC AAA GGG UUU UAG 3’ Amino acids:A. In transcription, a region of DNA opens up. One strand, the template strand, serves as a template for synthesis of a complementary RNA transcript. The other strand, the coding strand, is identical to the RNA transcripf in sequence, except that it has uracil (U) bases in place of thymine (T) bases. Given the following piece of messenger RNA (MRNA): CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC... Answer the following questions. 1. List the complementary non-coding DNA sequence. This refers to the template strand. (Please insert a space every after three letters for easy checking of your papers. Thank you.) 2. List the DNA strand sequence complementary to the template strand. This refers to the coding strand. (Please insert a space every after three letters for easy checking of your papers. Thank you.) 3. List the amino acid sequence of the protein coded for. (Please insert a space every after one amino acid for easy checking of your papers. Thank you.)Answer the following questions regarding the diagram (below) showing translation. The ribosome is shown as the blue and green structure, the RNA is the horizontal line labeled with nucleotide abbreviations, and the tRNAs are shown as colored blocks with the anticodon paired to the codon. • What stage of translation is shown? elongation • Which position shows the "A" position? right side (no tRNA) • Which end of the RNA is the 5' end? left end • Which base of the anticodon of the blue tRNA "GAC" (as shown in the diagram) is the 5' end of the anticodon? the C U! UCUGCUACUAGUAACACGU
- Answer the following questions regarding the diagram (below) showing translation. The ribosome is shown as the blue and green structure, the RNA is the horizontal line labeled with nucleotide abbreviations, and the tRNAs are shown as colored blocks with the anticodon paired to the codon. • What stage of translation is shown? elongation • Which position shows the "A" position? right side (no tRNA) • Which end of the RNA is the 5' end? left end • Which base of the anticodon of the blue tRNA "GAC" (as shown in the diagram) is the 5' end of the anticodon? the C CUAGAC UAGAUCUGCUACUAGUAACACĞUIndicate the class of drug that is stopping polypeptide translation: change 30S subunit block ribosome attachment inhibits peptide bonding block ribosome movement block tRNA dockingAnswer the following questions regarding the diagram (below) showing translation. The ribosome is shown as the blue and green structure, the RNA is the horizontal line labeled with nucleotide abbreviations, and the tRNAs are shown as colored blocks with the anticodon paired to the codon. • What stage of translation is shown? elongation ⚫ Which position shows the "A" position? middle (contains blue tRNA) . Which end of the RNA is the 5' end? left end • Which base of the anticodon of the blue tRNA "GAC" (as shown in the diagram) is the end of the anticodon? the C CUAGAC AGAUCUGCUACUAGUAACACGU
- Describe the process of translating mRNA into proteins. Be sure to also include the following key terms: tRNA, ribosomes, codon, base pairs, cytoplasm, amino acids.Table 8.2: Transcription and translation of the first 7 codons in the B-globin chain of hemoglobin. Normal Sequence Mutated Sequence DNA DNA amino acid DNA DNA amino Codon MRNA Codon MRNA coding template strand coding template strand strand acid code code strand sequence sequence G 1 1 G G C 2 A 2 A 3 G G A A 4 4 C G A G G G G 7 A 7 A G G Shape of RBC Shape of RBC 23 3.Correct regarding transcript processing: (A) Influences the amount and kinds of MRNA assembled from structural genes B Nuclear envelope selectively regulates passage of transcripts Phosphorylation of translated protein D Snipping out of transcript regions; chemical modification of transcript before it arrives at ribosome control
- Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNATranscribe the corresponding mRNA strand from the given DNA strand: DNA: TAC GCA CCC AGC CTA TCC GTC ATT mRNA: Complete the corresponding DNA strand from the mRNA strand: DNA: mRNA: AUG ACU GCG CCC CGA UCC UGU UAA Translate the following mRNA sequence into its appropriate amino acid sequence: (abbreviate amino acids by first three letters. Example: Methionine abbreviates to MET mRNA: AUG CUU AGC ACU GUU GAU UAU UCG Given the amino acid sequence, complete a possible DNA strand that compliments the strand: DNA: mRNA: Amino Acids: Met – Lys – Pro – Arg – Ser – Leu - STOPDefine transcription and translation. Give 3 ways in which they are similar and 3 ways in which they are different.