Organ Stomach* Small Intestine* Structure Cardiac sphincter Cardiac region Pyloric sphincter Pyloric region Fundus Body Rugae Greater omentum* Lessor omentum* Peritoneum* Mesentery* Duodenum* Jejunum* Ilium* Villi Microvilli Plicae circulares Lacteals Tissue Type(s) Function(s)
Q: Which division of the autonomic nervous system would likely be activated if a student learned that…
A: The automatic regulation of essential bodily processes such as heart rate and blood pressure and…
Q: Most fat-soluble nutrients are absorbed in the A. lymphatic system B. vascular system C.…
A: Fat-soluble nutrients are a group of essential nutrients that dissolve in fat and other lipids. They…
Q: The above experiment, on DNA synthesis in the intact chromosomes of E. coli (with no virus…
A: DNA synthesis occurs during the DNA replication process that involves production of new DNA from the…
Q: Why don't my female canary eggs hatch their diet is good I just her vegetables and she has a big…
A: Female canaries typically need to incubate their eggs consistently for successful hatching. If the…
Q: Give typing answer with explanation and conclusion Electron transport and oxidative phosphorylation…
A: Electrochemical cells play a vital role in various scientific, industrial, and everyday…
Q: long polysaccharide chain
A: Carbohydrates:These are a group of organic compounds which serves as a primary source of energy for…
Q: Match the types of bonds to their definitions. lonic Bond Polar Covalent Bond Nonpolar Covalent Bond…
A: The ability of an atom to draw electrons into a chemical connection is known as electronegativity.…
Q: Select all that apply: Which antibiotics contain a beta-lactam ring structure? O Ciprofloxacin O…
A: Antibiotics are medicines used for killing bacteria and thereby reducing bacterial infections in…
Q: Transplant rejection is inevitable’. Argue for and against this statement including in your answer…
A: Transplant rejection refers to the body's immune response against a transplanted organ or tissue. It…
Q: 3. A hypothesis must contain which of the following variables? dixet ne zell nosal) bivoga (egn/boot…
A: The element or circumstance that the researcher purposefully modifies or regulates throughout an…
Q: Predict the most likely outcome if proteins did not have "R" groups. Without "R" groups, proteins…
A: The most likely outcome if proteins did not have "R" groups would be that proteins would not be able…
Q: Circulation in blood Immunocompetent, but still naive, lymphocyte migrates via blood A B C D E D…
A: Our immune system is divided into two types of immunity: the innate and the adaptive immune…
Q: Can you say that the microbial composition changes over time in each of the body locations? Give two…
A: In hot summer months, the higher ambient temperature would likely accelerate the decomposition…
Q: The taste, smell, and presentation of food have a ___________ influence on food digestion. A.…
A: Taste and smell are chemical senses. These have sensory receptors that give response to food…
Q: Behavioral adaptations, but not structural adaptations, contribute to natural selection. Question…
A: Natural selection can be defined as a non random process through which biological traits become more…
Q: Early Ca²+ release S LCS Ca²+ oscillator (SR load dependent) Potential causes: t-tubule loss reduced…
A: We are given the flow diagram of two interacting positive-feedback mechanisms during EADS (early…
Q: Most species of seafood that are selected for aquaculture are herbivores. True False Farmed…
A: The breeding of a variety of seafood species, comprising carnivores, herbivores, as well as…
Q: put the following in the correct order of the most directly visual processing pathway from eyes to…
A: The eyes are important sensory organs for vision in animals. The visual system consists of eyes and…
Q: It took a temperature of 135 degrees Celsius to kill all of the bacteria in a test tube in 10…
A: As more and more microbes were discovered and identified to be the cause of various infections or…
Q: Give only typing answer with explanation and conclusion What is the final concentration, as a ratio…
A: Medication is commonly administered in medical settings by diluting it in a solution, such as normal…
Q: Solvent Je ed After Ten Minutes llow one are attracted to the developing solution.
A: Thin Layer chromatography is depicted in the figure. This type of chromatography is used for the…
Q: Q16. A mother and father with normal vision have a colorblind Klinefelter son. Colorblindness is an…
A: When a male develops Klinefelter syndrome, he has an additional X chromosome, which causes his…
Q: The lining of the GI tract is called the mucosa. True False
A: The gastrointestinal (GI) tract is a long, hollow tube that extends from the mouth to the anus. It…
Q: Answer the following questions to check your understanding of the reading. 5. How many genes account…
A: Single nucleotide polymorphisms (SNPs) in GWAS are essential for understanding the genetic…
Q: Which of the following statements about Bacillus thuringiensis (Bt) corn are correct? Select all…
A: Genetically Modified Organism is referred to as GMO. Any living thing whose genetic makeup has been…
Q: In some types of colon cancer, stem cells have a mutation in the APC gene. What happens if the APC…
A: Colorectal cancer is a common type of cancer that affects the colon or rectum. It is also known as…
Q: The yellow coat color allele of mice (AY) is dominant for coat color over the wild type agouti…
A: In this type of questions it is important to perform cross and eliminate the lethal first because it…
Q: Hello, I need an resum or a scheme about Disorders of Coagulation that I will use to do an…
A: Title: Disorders of CoagulationIntroduction:Disorders of Coagulation are a group of medical…
Q: After the extinction of the dinosaurs, the next major group of primates to arise Group of answer…
A: Evolution is the progressive change in a species' features over a number of generations that depends…
Q: LABORATORY REPORTS Writup The Gram Stain and Bacteriophage exercises will require formal laboratory…
A: The term "bacteriophages" or "phages" alludes to infections that multiply and contaminate bacteria.…
Q: 8)Which one of the following is a proper scientific name of an organism? a. White oak tree…
A: The genus and the species make up the two halves of an organism's binomial nomenclature, which is…
Q: Which division of the autonomic nervous system would likely be activated if a student learned that…
A: When the student realizes they have forgotten about an exam that is about to begin in a few minutes,…
Q: where did pollen evolve on the phylogenrtuc tree
A: Pollen is a reproductive parts that developed in plants, specifically in the lineage of plants known…
Q: Give typing answer with explanation and conclusion How does the neural plate “rise” up from the…
A: Neural plateIt refers to a developmental structure that acts as the basis of the nervous system.…
Q: 49. Which one below is the largest unit within which gene flow can occur based on the biological…
A: In the field of biology, the concept of species holds significant importance. It serves as a…
Q: 1) Which type of animal junction is associated with linking the cytoplasm of cells and exchange of…
A: There are several types of junctions found in animal tissues that serve different functions. Here…
Q: A graduate student is trying to identify the gene coding for an enzyme found in a bacterial species…
A: Trinitrotoluene (TNT), a solid organic nitrogen chemical that is mostly utilised as an explosive and…
Q: 1) All of the following are functions of proteins within a membrane except __________.…
A: Membrane biology, which has implications for the study of cellular physiology, is the research of…
Q: 5. Anabolic steroid use can provide athletes with benefits during training and performance. Provide…
A: Anabolic steroids are also called anabolic-androgenic steroids. these category of drugs derivatives…
Q: DNA sequence A: 5' - 3' TAACTTAAGGCCAATCGAAATCTTAAGGCGGTATACGCGTTAACCTTAAGG 3' DNA sequence B: 5'…
A: Restriction enzymes are restriction endonucleases that have specific restriction sites and…
Q: syringes below, answer these six questions: QUESTIONS 1. Which syringe had the most floating disks?…
A: By the data given in the question we can see that this experiment is very much related to…
Q: In an experiment, the smaller the sample size, the more credible the results of the study. A) True…
A: "Male pattern baldness is a common condition that affects millions of men worldwide. The quest for…
Q: Estimate the pl values of alanine eTextbook and Media glutamate lysine
A: Answer 1) the PI value of the alanine is : 5.97 at 25 degree Celsius. Answer 2) the PI value of…
Q: what will be the trend in the graph of a an experimental result of potato slides whose % initial…
A: The issue is weighing potato slides over time while doing an experiment. The potato slides have…
Q: In addition to a spinal column, what key feature distinguishes members of Vertebrata from Chordata?…
A: Animals can be differentiated on the basis of the presence of backbone. Species with notocord or…
Q: A 4. You are given three different substances that are known mutagens. Using a variety of…
A: Mutagens are specific compounds that are responsible for increasing the frequency of mutations.…
Q: Most pathogens are found in this temperature group. O Psychrophile Mesophile O Thermophile
A: Answer : the pathogens are found in this temperature grouo are : mesophiles.
Q: 1. Identify the type of tissue present for the following organs. Then look for a disease or disorder…
A: Human esophagus is also called food pipe. Food passes through this pipe into the stomach. Human…
Q: 5 2 nts Help Save & Exit Review the discussion of evolution and Investigating Life 1.1. Which of the…
A: Moth collect mainly the orchid nectar as food. The orchid nectar helps in nutrition of moth. So it…
Q: your patient presents with music, coughing, and increased respiration efforts. This occurred…
A: Inhaling chlorine gas, a very poisonous chemical, can seriously harm the respiratory system. It…
Step by step
Solved in 5 steps
- Arteries of the Head and Neck Area Supplied Common carotid artery External carotid artery Internal carotid artery Arteries of the Upper Limbs Area of service Subclavian artery Axillary artery Brachial artery Radial artery Ulnar artery Arteries of the Lower Limbs Area of service External iliac artery Femoral artery Popliteal artery Anterior tibial artery Dorsal pedis artery Posterior tibial artery VEINS Veins of the Trunk Area drained Brachiocephalic vein Common iliac vein Hepatic portal vein Hepatic vein Inferior mesenteric vein Internal iliac vein Renal vein Splenic vein Superior mesenteric vein Veins of the Head and Neck Area drained External jugular vein Internal jugular vein…Veins of the Trunk Area drained Brachiocephalic vein Common iliac vein Hepatic portal vein Hepatic vein Inferior mesenteric vein Internal iliac vein Renal vein Splenic vein Superior mesenteric veinHave to label the aorta, capillaries, inferior vena cava, heart, pulmonary artery, pulmonary vein
- Splenic artery Inferior mesenteric artery Spleen Urinary bladder Inferior mesenteric vein Splenic vein Abdominal aorta Hepatic portal vein Celiac a, and branches Reset Zoom#3.Identify the artery labelled “A”Label the below figure with the correct artery using the list of arteries provided. 7 8 10 1 2 3 4 5 11 12 13 14 8 15 16 17 10 Ascending aorta Arch of aorta/aortic arch Thoracic aorta (posterior to heart) Abdominal aorta Superior mesenteric artery Brachiocephalic trunk/artery Splenic artery Left subclavian artery Celiac trunk Inferior mesenteric artery Right common carotid artery Renal artery Common hepatic artery Common iliac artery Gastric arteries Right subclavian artery Left common carotid artery 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11
- 9 Label the following veins on Figures 12.36 and 12.37, Figure 12.36 O Brachiocephalic vein O Cephalic vein OGreat saphenous vein O Internal jugular vein O Renal vein OSubclavian vein O Vertebral vein FIGURE 12.36 Major veins of the body Figure 12.37 O Hepatic portal vein OInferior mesenteric vein O Splenic vein OSuperior mesenteric vein FIGURE 12.37 Veins of the abdomen and the hepatic portal systemdifferentiate arterial circulation nof the brain and hepatic portal circulationVeins of the Upper Limb Area drained Brachial vein Cephalic vein Medial cubital vein Radial vein Subclavian vein Ulnar vein
- Arteries of the Trunk Area supplied Aorta Supplies oxygenated blood to all major arteries in systemic circulation. Ascending Aorta Aortic Arch Thoracic (descending) aorta Abdominal aorta Brachiocephalic artery Celiac trunk: Splenic artery Left gastric artery , Common hepatic artery Superior mesenteric artery Suprarenal artery Renal artery Inferior mesenteric artery Gonadal artery Common iliac artery Internal iliac artery Arteries of the Head and Neck Area Supplied Common carotid artery External carotid artery Internal carotid artery Arteries of the Upper Limbs Area of service Subclavian artery Axillary artery Brachial artery Radial artery Ulnar artery Arteries of the Lower Limbs Area of service External iliac artery…Veins of the Lower Limb Area drained Anterior tibial vein External iliac vein Femoral vein Popliteal vein Posterior tibial veinExplanation of bleeding exits